ID: 1019055773

View in Genome Browser
Species Human (GRCh38)
Location 6:169222268-169222290
Sequence CTCCGGCGTGTCCCTCAAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055773_1019055777 -4 Left 1019055773 6:169222268-169222290 CCACCTTGAGGGACACGCCGGAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1019055773_1019055779 1 Left 1019055773 6:169222268-169222290 CCACCTTGAGGGACACGCCGGAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055773_1019055783 14 Left 1019055773 6:169222268-169222290 CCACCTTGAGGGACACGCCGGAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1019055783 6:169222305-169222327 CGTGGGCTGGTCCTCCCAGTAGG 0: 1
1: 0
2: 2
3: 10
4: 110
1019055773_1019055778 -3 Left 1019055773 6:169222268-169222290 CCACCTTGAGGGACACGCCGGAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055773 Original CRISPR CTCCGGCGTGTCCCTCAAGG TGG (reversed) Exonic
903213913 1:21832832-21832854 CACTGGAGTCTCCCTCAAGGGGG + Intronic
904128988 1:28261600-28261622 CTCCAGAGTGTCTCACAAGGGGG + Intronic
915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG + Exonic
1075259524 10:120950254-120950276 CTCCGGCTTGTCCCTCTGCGCGG + Intergenic
1083572500 11:63768211-63768233 CTCGGGCCTGGCCCCCAAGGCGG + Intronic
1083986730 11:66220515-66220537 CTCTGGCATGTCCCTTAAGCAGG + Intronic
1091389522 12:117572-117594 CCCCGGCCACTCCCTCAAGGTGG - Intronic
1102200649 12:111055627-111055649 CTCCCGCCTGGCCCCCAAGGTGG + Intronic
1104944693 12:132410370-132410392 CTCTGGGGCGTCCATCAAGGAGG - Intergenic
1105704407 13:22960500-22960522 CTCCTGAGTGTCCCTGATGGTGG + Intergenic
1113269299 13:108655469-108655491 CAGCGGCGTGGCCCTCATGGAGG + Intronic
1121252683 14:92511620-92511642 CTCCGCCGTCTCCCTCAACAGGG - Intergenic
1122578401 14:102756071-102756093 CTCCGGAGGGTCCCTCGGGGAGG - Intergenic
1122722089 14:103727853-103727875 CGCCCTCGTGTCCCTCAAGGAGG + Exonic
1123832368 15:24154008-24154030 CTCCTCCATGTTCCTCAAGGTGG + Intergenic
1128718124 15:69925072-69925094 CTCCTGACTGTCGCTCAAGGTGG + Intergenic
1128750003 15:70141989-70142011 CTCCCGCGTGGCGCTGAAGGTGG + Intergenic
1134052114 16:11144590-11144612 CTCAGGCGTGGGCCTCAAGCTGG - Intronic
1137271859 16:46907500-46907522 CTCCTGTGTGTCCCTCAGGTCGG - Intronic
1138497250 16:57416109-57416131 CTCCGGCCTGTCACTCTGGGAGG + Intergenic
1138554305 16:57762951-57762973 CTCCGTCATCTCCCTCAGGGAGG + Intronic
1152161877 17:78673999-78674021 CTCAGGCGGGGCCCTCGAGGTGG - Intergenic
1152798645 17:82321092-82321114 CTCCGGCCCGACCCTCAGGGCGG + Exonic
929370886 2:41222813-41222835 CTCCTGCAGGTCCCCCAAGGAGG - Intergenic
932374966 2:71227330-71227352 AGCCGGCATCTCCCTCAAGGAGG - Intergenic
937349707 2:121153151-121153173 CTCTGGCGTGGTCCTCATGGAGG + Intergenic
1168978573 20:1986344-1986366 CTCCAGCTTCTCCCTCCAGGTGG + Intronic
1179641094 21:42747615-42747637 CTCCTGCTTTTCCCTCAAAGAGG + Intronic
1179979920 21:44890556-44890578 CTCCTGCGTGCCCCACATGGTGG + Intronic
1184254247 22:43278145-43278167 GTCCGGAATGGCCCTCAAGGTGG - Intronic
1185336333 22:50272266-50272288 CACCGGCGGCTCCCTCCAGGGGG - Intergenic
964553688 3:157912440-157912462 CTCTGGCATGTCCCTCATGGGGG - Intergenic
964649919 3:158999217-158999239 CTTGGGCCTGTCCCTCAAAGTGG + Intronic
968514037 4:1008993-1009015 CACCGGCGTCTCCCTCAACTGGG - Intergenic
968644481 4:1732731-1732753 GTCCGGCGTCTCCCTCGGGGAGG + Intronic
982109558 4:152041392-152041414 CTCCAGCGTCTCCCTCCTGGTGG + Intergenic
983237278 4:165193737-165193759 CTCCTATGTGTCCCTCAAGAAGG + Intronic
986438138 5:7755328-7755350 GTCCTGCGTCTCCCTCAGGGGGG + Intronic
998279923 5:140796278-140796300 CACCAGCGTGTCCATCGAGGTGG + Exonic
1001278750 5:170370678-170370700 CTCCCATCTGTCCCTCAAGGAGG + Intronic
1015525514 6:134172193-134172215 CTCCGGCGTGCCACAGAAGGTGG + Exonic
1017807051 6:157955013-157955035 CTCCCACGTGTCCCCCTAGGTGG - Intergenic
1018895924 6:168016936-168016958 CCCCGGCGTGTCTCTCAGTGGGG - Intronic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019618946 7:1980190-1980212 CTCAGGCGTGTCCCCCAGCGGGG - Intronic
1020418877 7:7976811-7976833 CTCCTGAGTGATCCTCAAGGAGG + Intronic
1038676844 8:29630505-29630527 CTCCAGAGTGTCCCTGTAGGAGG - Intergenic
1048163924 8:132045346-132045368 CTCAGGTGGGTCCCTGAAGGTGG - Intronic
1048542411 8:135354538-135354560 CTCAGGAGTGTCCGTGAAGGTGG - Intergenic
1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG + Exonic
1049905318 9:211271-211293 CTCCAGCTTGTCCCTAAAGCAGG - Intergenic
1051358195 9:16259117-16259139 CTCCTGCATGTCCTTCAAAGAGG + Intronic
1055912713 9:81370815-81370837 CTGCAGGGTGTCCCACAAGGGGG + Intergenic
1061848437 9:133400949-133400971 CTCTGGAGTGACCCTCAGGGAGG + Intronic