ID: 1019055774

View in Genome Browser
Species Human (GRCh38)
Location 6:169222271-169222293
Sequence CTACTCCGGCGTGTCCCTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 34}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055774_1019055778 -6 Left 1019055774 6:169222271-169222293 CCTTGAGGGACACGCCGGAGTAG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055774_1019055779 -2 Left 1019055774 6:169222271-169222293 CCTTGAGGGACACGCCGGAGTAG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055774_1019055783 11 Left 1019055774 6:169222271-169222293 CCTTGAGGGACACGCCGGAGTAG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 1019055783 6:169222305-169222327 CGTGGGCTGGTCCTCCCAGTAGG 0: 1
1: 0
2: 2
3: 10
4: 110
1019055774_1019055777 -7 Left 1019055774 6:169222271-169222293 CCTTGAGGGACACGCCGGAGTAG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055774 Original CRISPR CTACTCCGGCGTGTCCCTCA AGG (reversed) Exonic
906545606 1:46617332-46617354 CTTCTGGGGCTTGTCCCTCAGGG - Intergenic
1067524547 10:47030260-47030282 CTACCCCGGCGAGTTCCACAGGG + Intergenic
1077523273 11:3048896-3048918 CCACTCAGGTGTGTCACTCAAGG + Intronic
1084883852 11:72190620-72190642 TTTCTCCGGCGTGGCCCTCAAGG + Exonic
1088358426 11:108967014-108967036 AAACTCAGGCGTCTCCCTCACGG - Intergenic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1095097198 12:38155067-38155089 CTGCTTTGGGGTGTCCCTCATGG - Intergenic
1099105057 12:78486637-78486659 CTACACAGGCAGGTCCCTCATGG - Intergenic
1105704405 13:22960497-22960519 CTCCTCCTGAGTGTCCCTGATGG + Intergenic
1106330595 13:28735805-28735827 CTTCTCCTGCGTTTCACTCAAGG - Intergenic
1122865542 14:104602376-104602398 CACCTCCTGGGTGTCCCTCAGGG - Intronic
1125510630 15:40290760-40290782 CTTCTCCGACGTCTCCTTCAGGG + Exonic
1129457436 15:75683283-75683305 CTAGTCCTGTGTGTCCCTCAAGG + Intronic
1129726355 15:77903662-77903684 CTAGTCCTGCGTGTCCCTCAAGG - Intergenic
1138269625 16:55685843-55685865 CAACTCCGGACTGGCCCTCATGG - Intronic
1138497249 16:57416106-57416128 CCACTCCGGCCTGTCACTCTGGG + Intergenic
1142182594 16:88678486-88678508 CTTCTCCCGCATGTCCCTCCTGG - Exonic
1152068679 17:78124803-78124825 CTCCTCCGGCCTCACCCTCAGGG - Intronic
1161738861 19:6008060-6008082 CAGCTCCTGCGTGTCCCTCCCGG - Intronic
926129089 2:10289837-10289859 CTACACAGGTGTGTCCCTGAAGG - Intergenic
1179979919 21:44890553-44890575 CTGCTCCTGCGTGCCCCACATGG + Intronic
1184759136 22:46535142-46535164 CTCCACCAGCGTGTCCATCACGG - Exonic
956296064 3:67715039-67715061 CTAATCCAGTGTGTTCCTCAGGG - Intergenic
962108383 3:132417176-132417198 CCCCTCCGGCGTGTGCCTTAGGG - Intergenic
972671528 4:41216651-41216673 CTTCTCCGGCGTATCCCCGACGG - Intronic
982178449 4:152728283-152728305 CTGCTCCTTCGGGTCCCTCAAGG - Intronic
983397931 4:167226351-167226373 CTACTCAAGCATGTCCATCATGG + Intronic
986438135 5:7755325-7755347 CTGGTCCTGCGTCTCCCTCAGGG + Intronic
995691527 5:114831091-114831113 CAACTCAGGGGTGTCCCTGAAGG + Intergenic
1003306645 6:4934981-4935003 CAACTCCTGAGTGTCCCACAGGG + Intronic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1022197503 7:28082992-28083014 GTGCTCTGGCCTGTCCCTCATGG + Intronic
1038437076 8:27543762-27543784 CTTCTCCGCCGTGACCATCAGGG - Exonic
1049153844 8:141055261-141055283 CTGCTCCAGCTTGGCCCTCAGGG + Intergenic
1057911878 9:99025906-99025928 CAACTCCAGGCTGTCCCTCAGGG - Exonic
1061715623 9:132517097-132517119 CCACTTCTGGGTGTCCCTCATGG + Intronic
1186060926 X:5706204-5706226 CTACTCCAGATCGTCCCTCAAGG - Intergenic
1200081172 X:153577189-153577211 CTACTCCAGCGTGCCCCTCCCGG - Intronic
1200137019 X:153880101-153880123 CTACACCCGCAGGTCCCTCAGGG + Intronic