ID: 1019055775

View in Genome Browser
Species Human (GRCh38)
Location 6:169222278-169222300
Sequence GGACACGCCGGAGTAGCCAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055768_1019055775 3 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20
1019055769_1019055775 2 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20
1019055767_1019055775 4 Left 1019055767 6:169222251-169222273 CCCCGTGGTGGAGTTCACCACCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20
1019055765_1019055775 9 Left 1019055765 6:169222246-169222268 CCCGTCCCCGTGGTGGAGTTCAC 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20
1019055766_1019055775 8 Left 1019055766 6:169222247-169222269 CCGTCCCCGTGGTGGAGTTCACC 0: 1
1: 0
2: 2
3: 8
4: 70
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20
1019055762_1019055775 22 Left 1019055762 6:169222233-169222255 CCTCAGGTGCTCGCCCGTCCCCG 0: 1
1: 0
2: 0
3: 11
4: 243
Right 1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055775 Original CRISPR GGACACGCCGGAGTAGCCAT AGG Exonic
903223160 1:21880227-21880249 GGACAAGCCAGAATAGCCAATGG + Exonic
1077094722 11:794462-794484 GTACATGCCGAAGTAGCCCTCGG + Exonic
1084642783 11:70435775-70435797 GGACAAGCCGGAGTGGGCACAGG - Intronic
1098723968 12:73938816-73938838 GGACATGCTGGAGTAGGGATTGG - Intergenic
1103896739 12:124278145-124278167 GGAGACCCCGGAGCAGCCGTGGG + Intronic
1114946863 14:27693226-27693248 AGACCAGCTGGAGTAGCCATAGG + Intergenic
1129880590 15:79003941-79003963 GTACATGCTGGTGTAGCCATTGG + Exonic
1152335449 17:79697980-79698002 GGGCACGCCGGAAAAGCCACCGG + Intergenic
1165394161 19:35555255-35555277 GCAGACATCGGAGTAGCCATGGG - Exonic
943241691 2:185392770-185392792 GGACTAGCTGCAGTAGCCATGGG + Intergenic
948673043 2:239580842-239580864 GGAAACGCCGAAGAAGCCCTGGG + Intronic
948854216 2:240722531-240722553 GGAGGCGCTGGAGGAGCCATGGG + Exonic
1172977553 20:38918329-38918351 GGCCACGCCAGGGTTGCCATAGG - Exonic
953761372 3:45689651-45689673 GGCCTCGCCCGAGTAGCCATAGG + Intronic
997010831 5:129875405-129875427 GGACACACCTGAGTAACAATAGG + Intergenic
997248316 5:132370064-132370086 GGACAGGCCGGTGAAGCCATTGG - Exonic
1006772819 6:36567856-36567878 AGACACGGGGGAGCAGCCATAGG + Intergenic
1019055775 6:169222278-169222300 GGACACGCCGGAGTAGCCATAGG + Exonic
1026880821 7:73905619-73905641 GGATACGCGGGAGTCTCCATGGG - Intergenic
1026987284 7:74562406-74562428 GTACCCGCCTGACTAGCCATGGG + Intronic
1048033889 8:130658559-130658581 ACACACCCCGAAGTAGCCATTGG - Intergenic
1048553859 8:135457230-135457252 GGACACGCGGGAGGGGCCCTTGG + Intergenic
1057477287 9:95413460-95413482 GGAGACGCTGGAGTTCCCATGGG + Intergenic