ID: 1019055777

View in Genome Browser
Species Human (GRCh38)
Location 6:169222287-169222309
Sequence GGAGTAGCCATAGGCCCGCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055773_1019055777 -4 Left 1019055773 6:169222268-169222290 CCACCTTGAGGGACACGCCGGAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1019055768_1019055777 12 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1019055766_1019055777 17 Left 1019055766 6:169222247-169222269 CCGTCCCCGTGGTGGAGTTCACC 0: 1
1: 0
2: 2
3: 8
4: 70
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1019055774_1019055777 -7 Left 1019055774 6:169222271-169222293 CCTTGAGGGACACGCCGGAGTAG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1019055765_1019055777 18 Left 1019055765 6:169222246-169222268 CCCGTCCCCGTGGTGGAGTTCAC 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1019055767_1019055777 13 Left 1019055767 6:169222251-169222273 CCCCGTGGTGGAGTTCACCACCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34
1019055769_1019055777 11 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055777 Original CRISPR GGAGTAGCCATAGGCCCGCG TGG Exonic
903154945 1:21436834-21436856 GGTGCAGCCAGAGGCCCGGGGGG + Intergenic
910449102 1:87328930-87328952 GCAGGAGCCCTCGGCCCGCGCGG - Exonic
911440487 1:97920708-97920730 CGCGGAGCCACAGGCCCGCGTGG - Intronic
914675413 1:149904186-149904208 GGAGGAGCCCTAGGCCAGCCTGG - Exonic
917567702 1:176229864-176229886 GGAGTTGCCATGGGCCTGGGGGG - Intergenic
920832308 1:209476781-209476803 GGAGAAGCAATAGGCCCCCTTGG - Intergenic
1066048349 10:31613823-31613845 GGAGTAACCAGAGGCCAGGGTGG + Intergenic
1077204993 11:1337695-1337717 GGAGCCGCCATATGGCCGCGGGG - Intergenic
1085308802 11:75503906-75503928 GGATTAGACATAGGCCCCTGGGG + Intronic
1096124214 12:49107798-49107820 GGAGGAGCCATTGGCCAGCTTGG + Intronic
1107317551 13:39150072-39150094 GGAGTGGCCAGAAGCCCACGGGG + Intergenic
1121449881 14:94000547-94000569 GCAGGAGCCATAGGGCTGCGAGG + Intergenic
1127930560 15:63594326-63594348 GGAGTAGCCATAGGAAGGTGAGG + Intronic
1132581002 16:684567-684589 GGGCTCGCCGTAGGCCCGCGGGG - Intronic
1138497407 16:57416667-57416689 GGAGGAACCACAGGGCCGCGTGG - Intergenic
1141144919 16:81522403-81522425 GAAGTAGCCAGAGGCCAGAGGGG + Intronic
1144841229 17:18187301-18187323 GGAGTAGCCATAGGTAAGAGGGG + Intronic
1153953004 18:10072726-10072748 GCAGTGGCAATGGGCCCGCGGGG - Intergenic
1166157397 19:40924305-40924327 GGAGTAGCAAGAGGCCTGTGAGG - Intergenic
1167581932 19:50349965-50349987 GGAGTACCCAGAAGCCCTCGCGG + Intronic
931586986 2:63840527-63840549 GGAGTAGGCATTGGCCTGTGTGG - Intergenic
947749962 2:232526760-232526782 GGAGTGGCCATAGGCCAGGTGGG - Intronic
1173723348 20:45279253-45279275 GGAGTAGGCATAGGCGAGAGAGG - Intergenic
1174087362 20:48018722-48018744 GGAGGAGCCAGAGGCCAGTGCGG - Intergenic
1174128926 20:48328248-48328270 GGAGGAGCCAGAGGCCAGTGCGG + Intergenic
949865077 3:8540827-8540849 GGAGCAGACAGAGGCCCGTGAGG + Intronic
968632547 4:1659497-1659519 GAAGGAGCCACAGGCCCGCACGG + Intronic
987906786 5:24088210-24088232 GGAGTGGCCAGAGGCCTGGGTGG - Intronic
1012596152 6:101043184-101043206 GGAGTCGTCATAGGCCTGTGAGG + Intergenic
1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG + Exonic
1054781935 9:69173989-69174011 GGAGAAGCCCAAGGCCCGAGCGG - Intronic
1056510969 9:87305307-87305329 GGAGGAGCCATGGGCCTGCCCGG + Intergenic
1056954597 9:91072163-91072185 GGAGTAGCCCTTGGCCACCGAGG - Intergenic
1190244665 X:48683473-48683495 GGAGTAGTCATGGGCCTGGGTGG - Intronic
1199783460 X:151083489-151083511 AGAGGAGCCATAGGCCAGAGCGG - Intergenic