ID: 1019055778

View in Genome Browser
Species Human (GRCh38)
Location 6:169222288-169222310
Sequence GAGTAGCCATAGGCCCGCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055768_1019055778 13 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055766_1019055778 18 Left 1019055766 6:169222247-169222269 CCGTCCCCGTGGTGGAGTTCACC 0: 1
1: 0
2: 2
3: 8
4: 70
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055774_1019055778 -6 Left 1019055774 6:169222271-169222293 CCTTGAGGGACACGCCGGAGTAG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055765_1019055778 19 Left 1019055765 6:169222246-169222268 CCCGTCCCCGTGGTGGAGTTCAC 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055769_1019055778 12 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055767_1019055778 14 Left 1019055767 6:169222251-169222273 CCCCGTGGTGGAGTTCACCACCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019055773_1019055778 -3 Left 1019055773 6:169222268-169222290 CCACCTTGAGGGACACGCCGGAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055778 Original CRISPR GAGTAGCCATAGGCCCGCGT GGG Exonic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
911440486 1:97920707-97920729 GCGGAGCCACAGGCCCGCGTGGG - Intronic
914675412 1:149904185-149904207 GAGGAGCCCTAGGCCAGCCTGGG - Exonic
923412727 1:233725854-233725876 GAGAAGCCAAAGGCCCGTTTGGG + Intergenic
1076701428 10:132275233-132275255 GAGTAGCCATGGGGCCTGGTGGG - Intronic
1080669072 11:34359122-34359144 GAGTAGCCACAGGGCAGCGGCGG - Intergenic
1090807703 11:130212707-130212729 GAGAGGCCAGAGGCCTGCGTAGG + Intergenic
1106080355 13:26495659-26495681 TAGTAGCCATGGGCCCTGGTAGG + Intergenic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1146287289 17:31582440-31582462 AAGCAGCCTTGGGCCCGCGTGGG + Intergenic
1148199216 17:45738146-45738168 AAGTAGCCTGAGGCCCTCGTCGG + Intergenic
1150327394 17:64268144-64268166 GAGTAGCCCTGGGCCAGGGTAGG + Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
930566039 2:53021915-53021937 GAATAGCCATAGGTCCACCTCGG - Intergenic
931586985 2:63840526-63840548 GAGTAGGCATTGGCCTGTGTGGG - Intergenic
937290089 2:120776788-120776810 GAGGAGCCAGAGGGCCGAGTGGG + Intronic
1181737347 22:24892272-24892294 GAGTAGCCATAGGAGAGGGTCGG + Intronic
1185313847 22:50170500-50170522 GAGTAGCCGGAGGCGCGCGGCGG - Intergenic
951891810 3:27574617-27574639 GAGAAGCCATAGGCCCCAGCTGG - Intergenic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
985058281 4:186054906-186054928 GAGTATCCATAGGCCCAGGCTGG - Intergenic
987906785 5:24088209-24088231 GAGTGGCCAGAGGCCTGGGTGGG - Intronic
1017686098 6:156914753-156914775 GGGTGGCCAGAGGCCCGCTTTGG - Intronic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1035073616 7:156162596-156162618 GAGTGGCCATGGGCCGGCGGTGG - Intergenic
1044557696 8:93582053-93582075 GACTATCCATTGGCCCACGTGGG - Intergenic
1048239712 8:132729496-132729518 GAGTAGCCAGAGTCCTGCTTTGG + Intronic
1060944694 9:127563081-127563103 GGGCAGCCATGGCCCCGCGTGGG + Intronic
1062497969 9:136840511-136840533 GAGGAGCTCTAGGCCGGCGTGGG + Exonic
1196375756 X:115030858-115030880 GAGTAGCCCAAGGCCCTTGTTGG + Intergenic