ID: 1019055779

View in Genome Browser
Species Human (GRCh38)
Location 6:169222292-169222314
Sequence AGCCATAGGCCCGCGTGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 85}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019055773_1019055779 1 Left 1019055773 6:169222268-169222290 CCACCTTGAGGGACACGCCGGAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055769_1019055779 16 Left 1019055769 6:169222253-169222275 CCGTGGTGGAGTTCACCACCTTG 0: 1
1: 0
2: 0
3: 16
4: 138
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055768_1019055779 17 Left 1019055768 6:169222252-169222274 CCCGTGGTGGAGTTCACCACCTT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055766_1019055779 22 Left 1019055766 6:169222247-169222269 CCGTCCCCGTGGTGGAGTTCACC 0: 1
1: 0
2: 2
3: 8
4: 70
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055774_1019055779 -2 Left 1019055774 6:169222271-169222293 CCTTGAGGGACACGCCGGAGTAG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055767_1019055779 18 Left 1019055767 6:169222251-169222273 CCCCGTGGTGGAGTTCACCACCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85
1019055765_1019055779 23 Left 1019055765 6:169222246-169222268 CCCGTCCCCGTGGTGGAGTTCAC 0: 1
1: 0
2: 2
3: 5
4: 58
Right 1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG 0: 1
1: 1
2: 1
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019055779 Original CRISPR AGCCATAGGCCCGCGTGGGC TGG Exonic
900089394 1:913264-913286 AGCCGGAGGCCCACATGGGCGGG - Intergenic
901757547 1:11450580-11450602 AGCCAGAGGCCAGTGAGGGCAGG - Intergenic
901902993 1:12382510-12382532 AGCCATAGGCCTGTTTGGGGAGG + Intronic
902459047 1:16557572-16557594 TGCCAGAGACCCGAGTGGGCAGG + Intergenic
902493108 1:16850344-16850366 TGCCAGAGACCCGAGTGGGCAGG - Intronic
903152238 1:21418337-21418359 TGCCAGAGACCCGAGTGGGCAGG + Intergenic
904160364 1:28518383-28518405 CGACTTAGGCCCGCGTGGACCGG - Intronic
904441421 1:30534412-30534434 AGGAAGAGGCCAGCGTGGGCTGG + Intergenic
905337481 1:37255529-37255551 AGCCAGGGGCCCACGTGGGAGGG + Intergenic
907461582 1:54608665-54608687 AGCCAGAGGCCCTGGAGGGCAGG - Intronic
911440485 1:97920703-97920725 AGCCACAGGCCCGCGTGGGCAGG - Intronic
915722301 1:157993976-157993998 AGCAATGGGGCCGCGAGGGCTGG + Intronic
916303842 1:163306511-163306533 AGCCAGAGGCCTTCCTGGGCAGG - Intronic
922079670 1:222283619-222283641 GGCCATGGGCCCGCCTGGCCTGG - Intergenic
1063735441 10:8748668-8748690 AGCCATAGGCCCTTGTGGTCTGG + Intergenic
1071086838 10:81875273-81875295 AGGCATGGGGCCGCGCGGGCCGG - Intergenic
1076519973 10:131075428-131075450 AGCCTTAGGCCTCCGTGCGCTGG + Intergenic
1083982194 11:66181499-66181521 AGCAATAGGGCCGGGTGGGGTGG - Intronic
1084153584 11:67302332-67302354 AGCCATAGCCCCGGGAGGGCTGG + Exonic
1084968380 11:72756164-72756186 AGCCAGAGGCCTGTGTGGTCAGG - Intronic
1086850272 11:91799923-91799945 AGCCATGGGCCAGAGTGGGATGG + Intergenic
1088990593 11:114950166-114950188 AGGCATAGGCCAGTGTGGGGAGG + Intergenic
1095954021 12:47796326-47796348 AGTCAGAGGCCAGGGTGGGCAGG + Intronic
1096254961 12:50057402-50057424 AGCCATAGGGCCTCGCAGGCAGG + Intergenic
1112508776 13:99990939-99990961 AGCCACAGGCTCGCGTGAGTGGG + Intergenic
1122456732 14:101859334-101859356 TGCCTTATGCCCACGTGGGCGGG + Intronic
1129404833 15:75309234-75309256 AGGCAGAGCCCCGGGTGGGCTGG + Intergenic
1130411624 15:83653480-83653502 AGCCATAGGCACTCCTGGCCAGG - Intergenic
1131056563 15:89378604-89378626 AGCTCCAGGCCCGCGGGGGCCGG - Intergenic
1136412083 16:30083444-30083466 AGCCATAGACCTGCGTGATCTGG - Exonic
1138263514 16:55643218-55643240 AGCCAGAGGCAGGGGTGGGCAGG + Intergenic
1138558868 16:57788303-57788325 AGTCCTTGGCCAGCGTGGGCTGG - Intronic
1139432966 16:66920936-66920958 AGCCATGGGCATGGGTGGGCAGG + Intergenic
1141110439 16:81266991-81267013 AGCCGTAGGCCTGGGTGGGGAGG + Intronic
1142434672 16:90048383-90048405 AGCCATAGAACTGCGTGTGCCGG + Intergenic
1146671465 17:34740909-34740931 AGCCCGAGGCCTGCGTGGGGAGG - Intergenic
1150389021 17:64780365-64780387 AGCCCAAGGGCCGGGTGGGCGGG + Intergenic
1151378973 17:73711733-73711755 AGCCATAGGCTCCCATGAGCTGG + Intergenic
1152301174 17:79495858-79495880 AGGCAGAGGCCCCTGTGGGCAGG + Intronic
1160444384 18:78915624-78915646 AGCCATGGGGCCGCAGGGGCTGG + Intergenic
1162818720 19:13210415-13210437 ACCCATAAGCCCTGGTGGGCGGG - Intronic
1163721705 19:18900986-18901008 TGCCATGGGCCGCCGTGGGCAGG - Intronic
1164467901 19:28503588-28503610 AGCCAGAGGGCCGTGGGGGCAGG - Intergenic
1165855795 19:38878778-38878800 AGCCACAGGCCCCCGGGGGCAGG + Exonic
1166700388 19:44878669-44878691 AACCCTAGGCCGGCGTGGTCAGG - Intronic
1167265507 19:48480989-48481011 AGCCAGAGGCCCTCCTGGGGCGG - Intronic
933997142 2:87678401-87678423 AGCCATAGTCCATCCTGGGCAGG + Intergenic
936091118 2:109501949-109501971 AGCCACAGGCCTGCCTGCGCCGG - Intronic
936296708 2:111272509-111272531 AGCCATAGTCCATCCTGGGCAGG - Intergenic
938406279 2:131034980-131035002 AGCCCCAGGCCCGCGAGCGCAGG + Intronic
940637809 2:156319934-156319956 AGCCCTAGGCCTGCGAGCGCTGG - Intergenic
946185430 2:217978317-217978339 AGCCACAGGACCCCGAGGGCAGG - Intronic
948660565 2:239503868-239503890 AGACATAGGCCCGTGTGGGCAGG - Intergenic
1175345376 20:58269137-58269159 AGCCAGAGGCCTGTGGGGGCAGG + Intergenic
1178843528 21:36156662-36156684 GGCCATAGGCGCGCGGGGGCGGG - Intergenic
1179603577 21:42496994-42497016 AGTCAGAGGCCCGAGGGGGCTGG - Intronic
1180693787 22:17739317-17739339 GGCCTGAGGACCGCGTGGGCGGG - Intronic
1181435975 22:22911095-22911117 AGCTCTAGGCCCCCGTGGGTAGG - Intergenic
1182585730 22:31343463-31343485 AGCCAGATGCCCGCCTGAGCAGG + Intronic
1184464075 22:44658865-44658887 AGCCACAGGCCCTCATAGGCAGG + Intergenic
950499416 3:13354285-13354307 AGCCAGAGGCCAGCTTGGACAGG - Intronic
953421556 3:42757248-42757270 AGGCAAAGGCCCTGGTGGGCAGG + Intronic
954698721 3:52440904-52440926 AGCCCTAGGCCTGCTTGGCCAGG + Intronic
962476995 3:135763556-135763578 AGCCATGGGCCATGGTGGGCAGG - Intergenic
964304953 3:155329799-155329821 ACCCGTAGGCACGCGTGTGCAGG + Intergenic
964553214 3:157908312-157908334 AGCCATAGGCCTAAGTGGGGAGG - Intergenic
968607048 4:1540424-1540446 AGGCTTAGGCTCGGGTGGGCCGG + Intergenic
968787113 4:2630886-2630908 ACCCATGGGCCCTGGTGGGCAGG + Intronic
969526338 4:7705981-7706003 AGGCAGAGGCCAGCCTGGGCAGG - Intronic
973142097 4:46781863-46781885 CGGCTGAGGCCCGCGTGGGCAGG - Intronic
975702020 4:77075779-77075801 CGCCATAGGGCGGCGGGGGCCGG + Exonic
984219159 4:176952321-176952343 GGCCACAGGCTGGCGTGGGCAGG - Intergenic
985491472 5:182159-182181 CTCCATAGGCCCGGGTGGGCTGG - Exonic
986014022 5:3741588-3741610 TGGCAGAGGCCGGCGTGGGCTGG + Intergenic
997395897 5:133559698-133559720 AGCTATAGGTCGGTGTGGGCAGG - Intronic
1019055779 6:169222292-169222314 AGCCATAGGCCCGCGTGGGCTGG + Exonic
1019429255 7:991108-991130 AGCCCGAGGCCCACGTGGGGAGG + Intergenic
1022728079 7:32998658-32998680 AGCTAGAGCCCCGTGTGGGCTGG + Intronic
1025045574 7:55689361-55689383 AGCTAGAGCCCCGTGTGGGCTGG - Intergenic
1025263890 7:57440093-57440115 AGTCAGAGTCCCTCGTGGGCAGG + Intergenic
1025635344 7:63316016-63316038 AGTCAGAGTCCCTCGTGGGCAGG - Intergenic
1025647350 7:63432154-63432176 AGTCAGAGTCCCTCGTGGGCAGG + Intergenic
1034560148 7:151875307-151875329 AGCGTTAGGCACGTGTGGGCCGG + Intronic
1038524692 8:28262916-28262938 AGCCACAGTCCAGCATGGGCGGG + Intergenic
1040289336 8:46116386-46116408 AGCCATAGGGTGGCGTTGGCGGG - Intergenic
1040290755 8:46122893-46122915 AGCCATAGGGTAGCGTGGGCAGG - Intergenic
1040329736 8:46379732-46379754 AGCCACAGGGTGGCGTGGGCAGG + Intergenic
1048073192 8:131041684-131041706 AGGCAGAGGCACGCGCGGGCCGG + Exonic
1049154387 8:141057954-141057976 AGCCTTTGGCCCTCGAGGGCAGG - Intergenic
1049445277 8:142627613-142627635 TGCCATATGCCTGCTTGGGCTGG - Intergenic
1051291772 9:15552781-15552803 AGCCACAGCAGCGCGTGGGCAGG + Intergenic
1056750995 9:89351082-89351104 TGCCAGAGGCCTGTGTGGGCTGG - Intronic
1060526971 9:124326285-124326307 AGGGATAGGCCCGGGTGAGCGGG - Intronic
1198651105 X:138864611-138864633 AGCCAAAGGCCCATGTGGCCAGG + Intronic