ID: 1019056181

View in Genome Browser
Species Human (GRCh38)
Location 6:169225160-169225182
Sequence GGTCTGGGTTGAACACAAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019056170_1019056181 16 Left 1019056170 6:169225121-169225143 CCCATGAGCTGAGAGAGCACCCA 0: 1
1: 0
2: 1
3: 15
4: 190
Right 1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 84
1019056173_1019056181 -3 Left 1019056173 6:169225140-169225162 CCCACCGTCCAAGTCCTCCTGGT 0: 1
1: 0
2: 1
3: 12
4: 82
Right 1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 84
1019056174_1019056181 -4 Left 1019056174 6:169225141-169225163 CCACCGTCCAAGTCCTCCTGGTC 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 84
1019056175_1019056181 -7 Left 1019056175 6:169225144-169225166 CCGTCCAAGTCCTCCTGGTCTGG 0: 1
1: 0
2: 3
3: 31
4: 282
Right 1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 84
1019056171_1019056181 15 Left 1019056171 6:169225122-169225144 CCATGAGCTGAGAGAGCACCCAC 0: 1
1: 0
2: 1
3: 17
4: 232
Right 1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 84
1019056168_1019056181 24 Left 1019056168 6:169225113-169225135 CCTCCACGCCCATGAGCTGAGAG 0: 1
1: 0
2: 0
3: 5
4: 146
Right 1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 84
1019056169_1019056181 21 Left 1019056169 6:169225116-169225138 CCACGCCCATGAGCTGAGAGAGC 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019056181 Original CRISPR GGTCTGGGTTGAACACAAGC CGG Exonic
901845679 1:11980585-11980607 GGTCTGGGATGCAGTCAAGCGGG + Intronic
902203086 1:14848440-14848462 AGGATGGGGTGAACACAAGCTGG + Intronic
902596150 1:17510704-17510726 GGTCTAGGTGGAACAGAAGTGGG - Intergenic
904476564 1:30768953-30768975 GGCCTGGGATGAGCAGAAGCAGG + Intergenic
904598581 1:31661745-31661767 GGTATGAGTTGGATACAAGCTGG - Intronic
908646379 1:66282494-66282516 TGTCTTGCTTGAACACAAGGAGG + Intronic
916416804 1:164599923-164599945 GGTCTGAGTTGCACACACACTGG - Intronic
919178851 1:194056270-194056292 GGTCTGGCTTGGACACACTCTGG + Intergenic
923424839 1:233858699-233858721 TTTCTGGGTTGAACACATGGAGG - Intergenic
1062874889 10:935049-935071 GGGCTGGGCTGAAGACAGGCTGG - Intergenic
1063203369 10:3807258-3807280 GGTCTGATTTGAACTGAAGCAGG - Intergenic
1066043892 10:31579776-31579798 GGTGTGGGCTGAGCACAGGCTGG + Intergenic
1070596408 10:77835716-77835738 GGTATGGGGTGACCTCAAGCTGG - Exonic
1071974491 10:90941101-90941123 GGTCTGGGATGTACACAAAGTGG + Intergenic
1077322348 11:1947924-1947946 GGTCTGGGCTGAGCAGAACCGGG - Intronic
1083274013 11:61586883-61586905 GGTCTGAGCTGCAGACAAGCTGG - Intergenic
1083687194 11:64383615-64383637 GGTCTGGGTTGACCCCAGGCAGG - Intergenic
1083699678 11:64467702-64467724 GTTCTGGGTTGAACACATGGAGG + Intergenic
1089498529 11:118919680-118919702 GGTCTGGGAGGAACACAGGCTGG - Intronic
1202805366 11_KI270721v1_random:3237-3259 GGTCTGGGCTGAGCAGAACCGGG - Intergenic
1100176749 12:92039296-92039318 TGACTGGTTTGACCACAAGCAGG + Intronic
1102406085 12:112675552-112675574 AGCCTGGGTTTAACACAAGTTGG + Intronic
1105593167 13:21812561-21812583 GGTCCGGCTTGAACACTTGCTGG + Intergenic
1114036841 14:18637095-18637117 GTTCTGTGTGGCACACAAGCTGG - Intergenic
1114121798 14:19677948-19677970 GTTCTGTGTGGCACACAAGCTGG + Intergenic
1119225771 14:72943609-72943631 GGTTTGGGTTGGACCCAAGCTGG + Intronic
1122365251 14:101191375-101191397 GGGCTGGGTTGCACAAAGGCAGG - Intergenic
1125231170 15:37457982-37458004 TTTCTGGGCTGAACACAAACTGG - Intergenic
1135407049 16:22206269-22206291 GGTCTAGGTTGAGCAGAAGCGGG - Exonic
1137610660 16:49815048-49815070 GGTCTGGGATGAAACCAACCAGG + Intronic
1137889682 16:52146062-52146084 TGTCTGGGTAGAGCAGAAGCTGG - Intergenic
1146438336 17:32872247-32872269 GGTTTTGTTAGAACACAAGCAGG + Intronic
1147228763 17:39002041-39002063 GTTCTGGCTTGAACAGAAGCAGG - Intergenic
1150592262 17:66573928-66573950 GGTCTGTGTTAAACCCAGGCTGG - Intronic
1163701235 19:18787620-18787642 GGTCTGGGTTCCGCACCAGCGGG + Exonic
1164618476 19:29680421-29680443 GGTCTGACTTGATCACAGGCCGG + Intergenic
1165649311 19:37471575-37471597 GGTCTGGGCTGTACACAATTTGG - Intronic
931628066 2:64274894-64274916 GGTTTGGGTTCTACACAACCTGG + Intergenic
931684137 2:64779000-64779022 AGTCTGGATTGAAGACAAGCTGG + Intergenic
938189627 2:129264591-129264613 GGACTGGGATGAAGCCAAGCAGG - Intergenic
938678798 2:133667485-133667507 GGTCTGAGTGGAAAACAACCTGG - Intergenic
941716945 2:168774070-168774092 GCTTTGGGTTGAACTCAAGTTGG - Exonic
948574517 2:238941117-238941139 GGGCTGGGCTGAGCACAGGCAGG - Intergenic
948602883 2:239117244-239117266 ACTCTGGGCTGAAAACAAGCAGG + Intronic
948971628 2:241432363-241432385 GGTCTGGGATGAACCCAAGAAGG + Intronic
1170718369 20:18851929-18851951 TGTCTGGGGTGAACACCTGCAGG - Intergenic
1174060206 20:47827064-47827086 GGTCTGGGATTAACTCAACCTGG - Intergenic
1174071689 20:47904306-47904328 GGTCTGGGATTAACTCAACCTGG + Intergenic
1174152358 20:48494329-48494351 GGTCTGGGATTAACTCAACCTGG - Intergenic
1175380564 20:58559652-58559674 GGGCTGGGTTGAACGCCTGCTGG + Intergenic
1175521185 20:59603874-59603896 GGTGTGGGGTGAACACAGGCAGG - Intronic
1179202227 21:39235674-39235696 GCTCTGGGTTGGATACAAGGAGG + Intronic
1180460965 22:15564143-15564165 GTTCTGTGTGGCACACAAGCTGG - Intergenic
1181122683 22:20682514-20682536 AGTCTGGGTTGAAAAAAATCAGG + Intergenic
1181179744 22:21058571-21058593 AGTCTGGGTTGAAAAAAATCAGG - Intronic
1183216551 22:36483983-36484005 GGTCTGGCTTAGTCACAAGCAGG + Intergenic
1183395935 22:37570802-37570824 GACCTTGGTTGACCACAAGCTGG + Intronic
950224978 3:11226059-11226081 GGTATGGGGTGTACACGAGCAGG + Intronic
955298877 3:57757822-57757844 CGTCTGGTTTGATCACAAGACGG + Exonic
955388803 3:58503415-58503437 GATTTGGGTTGAAAACAAGTGGG + Intergenic
955485099 3:59427110-59427132 GTTCTGGGTGAGACACAAGCAGG - Intergenic
958666871 3:97151578-97151600 GGTCTGAGTTTAACACTATCTGG + Intronic
963009421 3:140755349-140755371 GTTCTGTTGTGAACACAAGCAGG - Intergenic
970583446 4:17493709-17493731 CATCTGGGTTGAACACATGGAGG - Intronic
979864483 4:125736825-125736847 TGTCTGGGTTTAACACAACAAGG + Intergenic
980064340 4:128167778-128167800 GGCCTGGGTTGAATACAAAGAGG - Intronic
986495017 5:8332857-8332879 GGTCAGCGGTGAACACAAGGTGG + Intergenic
987154077 5:15070381-15070403 GGTCTGGGTAAAGCACCAGCAGG + Intergenic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
1000409400 5:160922236-160922258 GGTCTGGGTTTATCACCAGCTGG + Intergenic
1003700810 6:8462722-8462744 GGTATGGGTGGCACCCAAGCAGG - Intergenic
1004568757 6:16824672-16824694 AGTGTGGGTTGTACCCAAGCAGG + Intergenic
1007384825 6:41513376-41513398 GATCTTTGTTGAACACAAACTGG + Intergenic
1019056181 6:169225160-169225182 GGTCTGGGTTGAACACAAGCCGG + Exonic
1019359062 7:595446-595468 GGTCTGTGGGGAACACAGGCAGG - Intronic
1022245415 7:28554411-28554433 GGTCTGGCTTGGATGCAAGCTGG - Intronic
1023644089 7:42291395-42291417 GGCCTGGCTTGAGCACATGCTGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1026619758 7:71939897-71939919 GGTCTGGGTTGTAAATCAGCTGG - Intronic
1027726980 7:81819045-81819067 GTTCTGATGTGAACACAAGCAGG - Intergenic
1027753959 7:82186358-82186380 GGTCTGGGATAAAGACAATCAGG - Intronic
1032128089 7:129209163-129209185 GGGCTGGGGTGAACTCATGCTGG - Intronic
1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG + Intergenic
1047654005 8:126955640-126955662 GGTATGGGTTGAAATCAAGTAGG + Intergenic
1054708405 9:68485854-68485876 GGTCTGGGTTTAGCTCAAGGGGG + Intronic
1056250650 9:84744757-84744779 GGTCTGGGTTGAATAAAATGTGG + Intronic
1060028056 9:120189874-120189896 GGTCTGGGTAGAGAACAAGGAGG + Intergenic
1060506035 9:124199089-124199111 GGTCTGTGTGGAACAGAGGCTGG - Intergenic
1061550902 9:131334171-131334193 GGCCAGGGCTGGACACAAGCTGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062587776 9:137257192-137257214 GGGCTGGCTTGTACACATGCTGG + Intronic
1062728744 9:138096582-138096604 GGTCTGGGCTGAATACGACCCGG + Exonic
1186084991 X:5977845-5977867 GGACTGTGTTGGACACAAGGAGG + Intronic
1186415815 X:9382306-9382328 TGAGTGGGTTGAACACAGGCAGG - Intergenic
1190876152 X:54461671-54461693 GGGCTGGGGAGAACACAATCTGG + Intronic