ID: 1019057779

View in Genome Browser
Species Human (GRCh38)
Location 6:169235570-169235592
Sequence CCCTAGTCTGCACAGACGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019057770_1019057779 25 Left 1019057770 6:169235522-169235544 CCCTGGGGAAGCCCTTGATGCTT 0: 1
1: 0
2: 1
3: 14
4: 170
Right 1019057779 6:169235570-169235592 CCCTAGTCTGCACAGACGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1019057775_1019057779 13 Left 1019057775 6:169235534-169235556 CCTTGATGCTTTGGGCCAAGCGC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1019057779 6:169235570-169235592 CCCTAGTCTGCACAGACGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1019057776_1019057779 -2 Left 1019057776 6:169235549-169235571 CCAAGCGCTCTGTAACTCACACC 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1019057779 6:169235570-169235592 CCCTAGTCTGCACAGACGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1019057769_1019057779 28 Left 1019057769 6:169235519-169235541 CCTCCCTGGGGAAGCCCTTGATG 0: 1
1: 0
2: 3
3: 15
4: 176
Right 1019057779 6:169235570-169235592 CCCTAGTCTGCACAGACGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1019057771_1019057779 24 Left 1019057771 6:169235523-169235545 CCTGGGGAAGCCCTTGATGCTTT 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1019057779 6:169235570-169235592 CCCTAGTCTGCACAGACGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1019057774_1019057779 14 Left 1019057774 6:169235533-169235555 CCCTTGATGCTTTGGGCCAAGCG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1019057779 6:169235570-169235592 CCCTAGTCTGCACAGACGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019057779 Original CRISPR CCCTAGTCTGCACAGACGCA GGG Intronic
900621299 1:3588699-3588721 CCCCAGCCTTCACAGAGGCAGGG + Intronic
905460876 1:38122149-38122171 CCCTAGTCTGGACACATTCATGG + Intergenic
907788375 1:57636180-57636202 CCCGAGTGTGCACAGAGGAAAGG + Intronic
909371171 1:74885064-74885086 CCCTAGGCTGCACACACACAGGG - Intergenic
910118874 1:83762004-83762026 CGCTAGTCTGCAGAGAAGGAAGG - Intergenic
922116846 1:222621448-222621470 CCCTACTCTGTGCAGACCCAAGG - Intronic
924870514 1:248038821-248038843 CGCTAGCCTGCACAGACACTTGG + Exonic
1071173632 10:82898175-82898197 CCCCAGTGTGGACAGACTCAGGG - Intronic
1071575583 10:86723491-86723513 GCCTGGTTTGCACAGAGGCATGG + Intronic
1071918467 10:90323222-90323244 ACCCAGTCTGCCCTGACGCATGG - Intergenic
1076294667 10:129375310-129375332 CCCTGCTCTGCACAGGTGCAGGG - Intergenic
1076809846 10:132880749-132880771 CCAAAGCCTGCACAGACACATGG + Intronic
1079119510 11:17671988-17672010 GCCTGGTCTGCAGAGACACATGG + Intergenic
1083730062 11:64648072-64648094 CCCTTGTCTGCAGAGTCCCAGGG - Intronic
1084055508 11:66629515-66629537 CCACAGTCTGCACAGACGGTTGG + Intronic
1085400442 11:76232686-76232708 CCCAAGCCTCCACAGATGCAGGG - Intergenic
1085410198 11:76286251-76286273 CCCTGGCCTGCACAGGAGCAAGG + Intergenic
1086918197 11:92555634-92555656 TCCTTGTCTGCTCAGACACAAGG - Intronic
1087430541 11:98047799-98047821 CCCTAGTCTGCACAGTGATACGG - Intergenic
1090137103 11:124209981-124210003 CCCAAGTCTGCAGAGATGCCTGG + Intergenic
1092273834 12:7044213-7044235 CCCCAGTGTGCACAGCAGCAGGG - Intronic
1099655025 12:85478938-85478960 CTCTAGCCTGCAAAGACACAGGG - Intergenic
1101663602 12:106788726-106788748 CCCTAGGCTGCACACAGCCAGGG + Intronic
1103518723 12:121523894-121523916 CCCTCCTCTGCACAGAAGCATGG + Intronic
1114986711 14:28238789-28238811 CCCTAGTCTGCACAGAGCAGGGG - Intergenic
1118364636 14:65084010-65084032 CCAGAGTCAGCACAGACCCATGG + Intronic
1119862609 14:77947557-77947579 CCCAAGGCTGCACACAGGCAGGG - Intergenic
1122610960 14:102983210-102983232 GCGTCGTCTGCACAGGCGCATGG - Intronic
1126141332 15:45441839-45441861 TCCTCGTCTGCACAGACGAGTGG - Intronic
1127455718 15:59154455-59154477 CCCGAGTCTGCCAAGACGCATGG - Intronic
1129660602 15:77550877-77550899 CCCTGCTCTGGAGAGACGCAGGG - Intergenic
1130353030 15:83107906-83107928 CCCTAGTCTGGCCAGGCGCGGGG - Intronic
1133975024 16:10594614-10594636 CCCCAGTCTGCACTGACTCTGGG - Intergenic
1135064275 16:19296172-19296194 CCCTGGTCAGCACAGCCGCTGGG + Intronic
1139558617 16:67728113-67728135 TCCCAGCCTGCACAGACGCAGGG + Intronic
1152798265 17:82318581-82318603 CCCGTCTCTGCACACACGCATGG - Intergenic
1152798281 17:82318767-82318789 CCCGTCTCTGCACACACGCATGG - Intergenic
1152798303 17:82319018-82319040 CCCGTCTCTGCACACACGCATGG - Intergenic
1152798377 17:82319819-82319841 CCCGTCTCTGCACACACGCATGG - Intergenic
1152798380 17:82319851-82319873 CCCGTTTCTGCACACACGCATGG - Intergenic
1153712875 18:7818011-7818033 CCCTAGGCTGCCCTGACCCAGGG - Intronic
1154258631 18:12808974-12808996 CCCTAGACTGAACAGTGGCAAGG - Intronic
1157377792 18:47182249-47182271 CCCTAGGCTGCACACAGGAAAGG - Intergenic
1160082996 18:75747695-75747717 CCATAGTATGCACATACCCAAGG + Intergenic
934772153 2:96913899-96913921 CCCTCCTCTGCACAGAAGCCGGG - Intronic
935927753 2:108088959-108088981 CCCTAGGCTACACACAAGCATGG - Intergenic
937547170 2:123036497-123036519 CCCTAGGCTGCACAGACTTGAGG + Intergenic
938402610 2:131005600-131005622 CCCTAGTCTTCCCAGTCCCAGGG + Intronic
1171290748 20:23981656-23981678 TCCCAGTCTGCACAGACGACAGG + Intergenic
1175260452 20:57670680-57670702 CCCCAGCCAGCACAGACCCAAGG + Intronic
952749754 3:36815692-36815714 CCTGAGTCGGTACAGACGCAAGG + Intergenic
954466250 3:50656803-50656825 CCCTAGCCTGCACTCACTCACGG - Intergenic
956635104 3:71356043-71356065 GCCGAGTCAGCACAGAGGCAGGG + Intronic
957870891 3:86089552-86089574 CCCTAGGCTGCACAGACCAGAGG + Intergenic
958583210 3:96052678-96052700 CCCTAGGCTGCACAGAGCAAGGG + Intergenic
962027263 3:131561263-131561285 CCCTAGTCTGCTCAAAGCCAAGG - Intronic
963028461 3:140942419-140942441 CCCGCGTCTCCTCAGACGCATGG - Intronic
964702147 3:159580338-159580360 CCAGAGCCTGCACAGACACAGGG + Intronic
968381740 4:102284-102306 CCCTATTTTGCACAGCCTCAGGG - Intergenic
969884535 4:10203679-10203701 CACAGGTCTGCACAGATGCACGG - Intergenic
972108608 4:35525838-35525860 CCCTAGCAGGCACAGACACAAGG - Intergenic
975376237 4:73649750-73649772 CCCTAGTCTACACACAAGAAAGG - Intergenic
985437184 4:189941230-189941252 CCCCTCTCTGCACAGACGCCGGG - Intronic
990193330 5:53286494-53286516 CCCTAGGCTGCACACGCACAGGG + Intergenic
991014604 5:61917456-61917478 CCCTAGTCTGCACAGGTGCTAGG - Intergenic
997382711 5:133449161-133449183 CTATGGTGTGCACAGACGCAGGG - Intronic
1001124014 5:169003292-169003314 CCCTGGTCTGCCCAGAAGCTAGG - Intronic
1001226767 5:169951243-169951265 CCCTAGTGTGGACAGTCTCAGGG + Intronic
1001401198 5:171447463-171447485 CCCTAGTCAACACTGACTCAGGG - Intronic
1004834539 6:19516138-19516160 CCCTAGGCTGCACAGAGCCGGGG - Intergenic
1006357997 6:33572096-33572118 CCACAGTCAGCACACACGCAGGG - Intergenic
1006741583 6:36312779-36312801 CCCTACTCTGGACAGACTGATGG + Intergenic
1008859635 6:56133700-56133722 CCCTAGGCTGCACAGAGCAAGGG - Intronic
1012137131 6:95572406-95572428 CCCTATTCTGCAAACAGGCATGG - Intergenic
1017047724 6:150363292-150363314 CCCTAGTCTCCAAAAATGCAAGG + Intergenic
1018454359 6:163939155-163939177 CCACAGGCTGCACAGAAGCATGG + Intergenic
1019057779 6:169235570-169235592 CCCTAGTCTGCACAGACGCAGGG + Intronic
1019136041 6:169908175-169908197 CCCTGCTCAGCACAGACTCAGGG - Intergenic
1024207532 7:47176811-47176833 CCCTAGACTGCACACAGCCAAGG - Intergenic
1024613677 7:51088914-51088936 ACCAAGTCTGCACCGACACAGGG - Intronic
1026660110 7:72293242-72293264 CCCTAGTCTGGAAGGACGTAGGG + Intronic
1027409440 7:77899371-77899393 CCCTAATTTGCAGACACGCATGG - Intronic
1035131164 7:156654978-156655000 CAGTTGTCTGCACAGCCGCATGG - Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035358797 7:158296224-158296246 CCCTAGTGGGCAAAGACACAAGG + Intronic
1038638968 8:29308762-29308784 CACTAGTCTGCACTGACGATTGG - Intergenic
1046439172 8:114236371-114236393 CCCTAGCGGGCACAGACACACGG + Intergenic
1047777482 8:128085060-128085082 CACAAGCCTGCACAGACTCAAGG - Intergenic
1056702063 9:88918983-88919005 CCCTAGGCTGCACAGAGCAAGGG + Intergenic
1062004197 9:134231118-134231140 AGGTTGTCTGCACAGACGCAGGG - Intergenic
1062111911 9:134786427-134786449 CCCCAGTCGGCACAGACACCTGG + Intronic
1185534336 X:848685-848707 CCCTTGGCTGGACAGACTCAGGG - Intergenic
1194419009 X:93649584-93649606 CCCTAGGCTGCACAGAACAATGG - Intergenic
1197561265 X:128024846-128024868 CCCTAGCCTGCACACACAGAGGG + Intergenic
1199985859 X:152949617-152949639 CCCTAGTCTGGGCACACGCCAGG + Intronic
1201452225 Y:14129031-14129053 CCCTAGTCTGCACATAGGATGGG - Intergenic
1202018236 Y:20434742-20434764 GCCTAGTATGCACACACTCAGGG - Intergenic