ID: 1019057833

View in Genome Browser
Species Human (GRCh38)
Location 6:169235898-169235920
Sequence GGACAGAGGGAGAGTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1356
Summary {0: 1, 1: 0, 2: 8, 3: 136, 4: 1211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019057833 Original CRISPR GGACAGAGGGAGAGTGTGGA TGG (reversed) Intronic
900069906 1:762787-762809 GGAGAGAGGGAGGGAGGGGAAGG + Intergenic
900131650 1:1089749-1089771 GGACAGAGTGAGAAGGTGCAAGG - Intronic
900163977 1:1237389-1237411 GGACAGAGGCCGAGGCTGGATGG - Intergenic
900187552 1:1339470-1339492 GGACAGATGGACAGGGTGGGAGG + Intronic
900320837 1:2082844-2082866 GGCGTGAGGGAGAGGGTGGAGGG + Intronic
900745387 1:4357154-4357176 AGAGAGAGAGAGAGTGTGAATGG + Intergenic
900805316 1:4763744-4763766 AGACAGAGGGAGAGGGAGAAAGG - Intronic
900809051 1:4787336-4787358 GGGAAGAGGGAGAGAGTGGGGGG + Exonic
900830148 1:4959947-4959969 GGACAGAGGAAGGGAGGGGAGGG + Intergenic
900918572 1:5656209-5656231 GGAGAGAGGGAGGGAGGGGAGGG + Intergenic
900932920 1:5747902-5747924 GGAGAAAGGGAGAGGGAGGAGGG + Intergenic
901452265 1:9342983-9343005 GGACAGGGGGTGGGTGTGGATGG - Intronic
901462964 1:9402469-9402491 GGAAAGTGTGAAAGTGTGGAAGG - Intergenic
901651686 1:10746726-10746748 GGGCAGAGGGACAGAGCGGAGGG + Intronic
901773227 1:11541642-11541664 TGACAGAGGCAGGGTGAGGAAGG - Intergenic
901874333 1:12158365-12158387 GGACAGAGAGTGGGTTTGGAGGG + Intergenic
902040089 1:13486204-13486226 AGACAGAGGGAGAGGCTGGAGGG - Intronic
903049097 1:20587678-20587700 GGCCAGCAGGAGAGTTTGGATGG - Intergenic
903325565 1:22566881-22566903 GGACAGAGGAAGAGGAGGGAGGG + Intronic
903585965 1:24415522-24415544 GGACAGCGGGAGAGGGGGCAGGG + Intronic
903606742 1:24580395-24580417 GGACGGAGGGAAGGGGTGGAGGG + Intronic
903886812 1:26545701-26545723 GGAGAGGGGGAGAGAGAGGAAGG + Intronic
904250766 1:29222693-29222715 GGAGAGAAGGAGAGTGAAGAGGG + Intronic
904316504 1:29669624-29669646 GGTCAGGAGGAGAGTGGGGAGGG - Intergenic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
904902679 1:33869775-33869797 AGAGAAAGGGAGAGTGGGGAGGG - Intronic
904998940 1:34652970-34652992 GGACAGAGAGCGAGGGTTGATGG - Intergenic
905768913 1:40624942-40624964 GGACAGTGGAGGTGTGTGGAAGG - Exonic
905778306 1:40685470-40685492 GGACAGAGGGAAGGTGTTCAAGG + Intergenic
905804866 1:40869073-40869095 GGACACAGGGAGGGAGAGGAAGG - Intergenic
905923367 1:41733462-41733484 GGATATAGGGAGAGGCTGGATGG - Intronic
905973199 1:42156151-42156173 AGACAGAAGGAGAGAGTGGAGGG + Intergenic
906204550 1:43979802-43979824 GGGCAGGGGGAGTGGGTGGAGGG - Intronic
906646311 1:47478041-47478063 GGACAAAGGGACAGTGGGGAGGG - Intergenic
906795403 1:48692781-48692803 GGAGAGAGTGAGAGGATGGAGGG - Intronic
907356143 1:53875619-53875641 GGTGAGAGAGACAGTGTGGAGGG - Intronic
907654161 1:56325330-56325352 GGAGCGAGAGAGAGAGTGGAGGG + Intergenic
907687065 1:56622625-56622647 GGAGAGAGAGAGAGTGTGCAGGG - Intronic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
908600733 1:65737184-65737206 AGACAGAGAGAGAGTGAAGAGGG - Intergenic
908677377 1:66620547-66620569 AGACAGAGAGAGAGAGTGGGAGG + Intronic
911012376 1:93294627-93294649 GTGCAGTGGGAAAGTGTGGATGG + Intergenic
911218345 1:95219973-95219995 GTACAAAAGGAGAGTGGGGAAGG - Intronic
911587188 1:99704713-99704735 GGACAGCGAGAGGATGTGGATGG + Intergenic
911874572 1:103143224-103143246 GGACAGAGAGGGAGTGTACATGG - Intergenic
911950681 1:104170415-104170437 GGAAGGAGGGTGATTGTGGAAGG + Intergenic
912128314 1:106568971-106568993 GGAGGGAGGGAGAGAGTGGGAGG + Intergenic
912275733 1:108256571-108256593 GGAGAGAGGGAGGGAGGGGAGGG - Intergenic
912292493 1:108437783-108437805 GGAGAGAGGGAGGGAGGGGAGGG + Intronic
912570494 1:110617725-110617747 AGAGGGAGAGAGAGTGTGGAGGG + Intronic
912595590 1:110872667-110872689 AGACAGAGGGAGTATGAGGAGGG + Intergenic
912727348 1:112069831-112069853 GGGCAGAGGGAGAGTGGTGGGGG - Intergenic
912775011 1:112501345-112501367 GTACAGACAGGGAGTGTGGAGGG - Intronic
912936379 1:114007020-114007042 GGACAGAGACAGAGAGTGAAGGG + Intergenic
912951491 1:114123592-114123614 GGAAAGACGGAGAATGTGCAGGG - Intronic
913167196 1:116199369-116199391 GGCCAATGGGAGGGTGTGGAGGG - Intergenic
913176007 1:116273754-116273776 GGAGAGAGGGAGAGAGTGACTGG - Intergenic
915004647 1:152624441-152624463 GGGCAGAGGGGTAGAGTGGAGGG + Intergenic
915320609 1:155054025-155054047 GGAAAGAGGGAGGGGGTGGCTGG + Intronic
915733663 1:158071255-158071277 AGGCAGAGGGAGAGCGAGGAGGG - Intronic
915740710 1:158116435-158116457 GCAGAGAGGGAGAGAGAGGAGGG + Intergenic
916019392 1:160778866-160778888 GGACAGGTGGTGAGTGAGGATGG - Intergenic
916195396 1:162217640-162217662 AGGCAGAGTGAGAGTGTGGCTGG + Intronic
916415477 1:164588696-164588718 GGAGAGAGAGAGAGGCTGGAGGG + Intronic
916522786 1:165580249-165580271 GGAAGGAGGGAGAGAATGGAAGG + Intergenic
916530201 1:165649375-165649397 GGAGAGAGAGGGAGTGGGGAGGG - Intronic
916737983 1:167624985-167625007 AGAGAGAGGGAGAGGGAGGAGGG - Intergenic
916811162 1:168306968-168306990 GGACAGAGTGGGAGTGGGCAGGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917363680 1:174204823-174204845 GGAAAGAGAGAGAGAGTGAAGGG - Intronic
917809726 1:178646577-178646599 GGACAGAGGGAGGGAGGGAAGGG + Intergenic
917871705 1:179248063-179248085 GGAAAGAGAGAGAGGGAGGAAGG + Intergenic
918071962 1:181139749-181139771 GGCCAGAGGGAGGATGTGGCTGG + Intergenic
918076736 1:181176314-181176336 AGACAGAGGAAGAGAGAGGAAGG + Intergenic
918248685 1:182682837-182682859 GGACAGAGCAAGAGTGTGGATGG - Intronic
918286507 1:183060417-183060439 GGACAGAGGGACAGGGTAAAGGG - Intronic
918390534 1:184055226-184055248 GGAGTGAGAGAGAGTGTTGAGGG + Intronic
918991671 1:191704459-191704481 GGAGAGAGAGAGAGAGTGGGTGG - Intergenic
919748862 1:201024402-201024424 GGCCAGAGGGTCAGTGTGGGAGG + Intergenic
920501430 1:206487841-206487863 GGAAAGAGGGAGGGAGGGGAAGG - Intronic
920646335 1:207806788-207806810 GGACAGCAGGAGACAGTGGAGGG + Intergenic
920694182 1:208169325-208169347 AGACACAGGGAGAGTTCGGACGG + Intronic
921188483 1:212689591-212689613 GGGCAAGGGGAGAGTCTGGATGG + Intronic
921193864 1:212733483-212733505 GGAAAGATGGAGAGGGTGGAAGG - Intronic
921320208 1:213931288-213931310 GGACACAGGGAGACTAGGGAGGG - Intergenic
921321329 1:213942619-213942641 GGACTGATGGAGTGTGTGGCAGG - Intergenic
921333547 1:214064237-214064259 TGACAGAGGGAGGGTCGGGATGG + Intergenic
921397964 1:214689067-214689089 GGAAAGGGGGAGGGTGTGGAGGG - Intergenic
921458175 1:215396638-215396660 GGACAGACGGAGAAGGTAGAAGG + Intergenic
921771571 1:219046860-219046882 GGAGAGAGGGAGAGTGAAGGAGG + Intergenic
921833999 1:219759383-219759405 GGAGGGAGGGAGAGAGAGGAAGG + Intronic
921891668 1:220360005-220360027 GGACAGAAATAGAGTGTTGAGGG - Intergenic
922107815 1:222527546-222527568 GGAGAAATGGAGAGTGGGGAGGG - Intronic
922331638 1:224582055-224582077 GGACAGAGGGGGTGTGGGGAGGG + Intronic
922750825 1:228069330-228069352 GTATAGAGGGATAGTGTGGGGGG + Intergenic
922772794 1:228196992-228197014 AGACAGAGGCAGAGACTGGAGGG - Intergenic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
923622038 1:235587467-235587489 GGTGAGTGTGAGAGTGTGGATGG + Intronic
924208794 1:241743490-241743512 GGTAAGAGGGGGAGTGCGGAGGG - Intronic
924454596 1:244208977-244208999 GGACAGAGGTACAGTAGGGAAGG - Intergenic
924573861 1:245261516-245261538 GGAGAGAGGGAGAGAGAGGGAGG - Intronic
924593555 1:245426186-245426208 GGAGGGAGGGAGAGAGAGGAAGG - Intronic
1062961296 10:1575611-1575633 GGACTGAGGGAGAGAGAGGGTGG - Intronic
1063044073 10:2373749-2373771 GGAGAGAGAGAGAGGATGGAAGG - Intergenic
1063481235 10:6378365-6378387 GGAGAGAGAGAGAGAGTGAAGGG + Intergenic
1063511218 10:6646932-6646954 GGAGAGAGGGAGAGAGGGAAAGG - Intergenic
1063631943 10:7742239-7742261 CGGGAGAGGGAGAGTGGGGATGG + Intronic
1063692177 10:8297199-8297221 AGACAGAGAGAGAGAGAGGAAGG - Intergenic
1063717363 10:8541328-8541350 GGAGAGAGAGAGAGAGTGCAGGG + Intergenic
1063876453 10:10484124-10484146 GGAGGGAGGGAGAGAGAGGAGGG - Intergenic
1063984169 10:11483587-11483609 GGAGAGAGGGGGAGGGGGGAGGG + Intronic
1064367196 10:14718530-14718552 GGACAGAGAGAGAGAGAGGAAGG + Intronic
1064596934 10:16954802-16954824 GGAAGGAAGGGGAGTGTGGAAGG - Intronic
1064795547 10:19007584-19007606 GGAGGGAGGGAGAGTGGGGAGGG - Intergenic
1064822115 10:19348979-19349001 CGACAGAGTGAGACTGTTGAAGG - Intronic
1064871177 10:19938494-19938516 GGACTGAGAGAGAGTTTGGCGGG + Intronic
1065159268 10:22902323-22902345 GGCAAGAGAGAGAGTGTGCAGGG + Intergenic
1065218083 10:23470048-23470070 AGACAGAGAGAGAGAGAGGAAGG - Intergenic
1065915974 10:30355325-30355347 GGAGAGAGGGAGACTGTGTTGGG + Intronic
1066283781 10:33944040-33944062 GGAGAGAGGGAGAGGGGAGAAGG + Intergenic
1067481486 10:46602270-46602292 GTACAGTTGGAGAGAGTGGAGGG + Intergenic
1067561007 10:47304386-47304408 GGAGAGAGGGAGAGAGAGGGAGG + Intronic
1067613266 10:47739459-47739481 GTACAGTTGGAGAGAGTGGAGGG - Intergenic
1067875487 10:50003422-50003444 AGACAGAGGGAAAGTGGAGATGG - Intronic
1068257334 10:54530170-54530192 GGAAAGGCGGAGAGTGAGGAAGG - Intronic
1069023388 10:63514629-63514651 GGAGGGAGGGAGGGGGTGGAAGG + Intergenic
1069045249 10:63736600-63736622 GGACCCAGTGAGAATGTGGATGG - Intergenic
1069115939 10:64506775-64506797 GGAGAGAGGGAGAGAGAGGTGGG - Intergenic
1069230161 10:65998587-65998609 GGAAAGAGGGATAGTGAGGAGGG + Intronic
1069640762 10:69954108-69954130 GGATGGAGGAGGAGTGTGGAGGG - Intronic
1069884289 10:71613848-71613870 GGACTGAGGAAGAGGATGGATGG - Intronic
1070360738 10:75686162-75686184 GGACAGAGGGCCACTGGGGATGG + Intronic
1070720679 10:78754841-78754863 GGACAGAGGAGCAGTGTGGCTGG - Intergenic
1070843364 10:79503328-79503350 GGAGAGAGAGAGAAGGTGGAGGG - Intergenic
1070930297 10:80256270-80256292 GGAGAGAGAGAGAAGGTGGAAGG + Intergenic
1070985422 10:80685845-80685867 GGACAGAGGTAGAGGGTAGGGGG + Intergenic
1071088480 10:81891942-81891964 GGACAGAGCGAGACAGAGGAAGG - Intronic
1071299380 10:84245072-84245094 GCAGTGAGGGAGAGTGAGGATGG + Exonic
1071409736 10:85377351-85377373 GGACAGAGAGAGAATAAGGAGGG + Intergenic
1071426341 10:85557761-85557783 GGAGAGAGGGAGAGAGGGAAAGG + Intergenic
1071450858 10:85790529-85790551 GGGCAGAGGGAGTGGGGGGAAGG + Intronic
1071538177 10:86454376-86454398 AGGGAGAGGGAGATTGTGGAGGG - Intronic
1071628676 10:87199564-87199586 GTACAGTTGGAGAGAGTGGAGGG - Intergenic
1071840333 10:89464040-89464062 GGACAGTGGGAGAGTGAGAGTGG - Intronic
1071962624 10:90821846-90821868 GGAGAGAGAGAGAGAGTGAAGGG - Intronic
1072459412 10:95605529-95605551 AGATGGAGGGAGAGTGGGGAGGG + Intergenic
1072564607 10:96607184-96607206 GCAGAGAGGGAGAGTGAGGATGG - Intronic
1072587037 10:96792009-96792031 GGAAAGAGGGAGAGGGAGGGAGG - Intergenic
1072587057 10:96792105-96792127 GGAAAGAGGGAGAGGGAGGGAGG - Intergenic
1073049087 10:100656321-100656343 GGACAGAGGGAGACTGGCGCGGG + Intergenic
1073076749 10:100829214-100829236 GGGCAGAGGGAGAGAGGGGCAGG - Exonic
1073142763 10:101260029-101260051 TGAAAGAGGGAGAATGAGGACGG + Intergenic
1073473710 10:103739464-103739486 GGAGAGAGGGAGGGCCTGGAAGG + Intronic
1073701633 10:105934255-105934277 GGTAATAGGCAGAGTGTGGAGGG + Intergenic
1073948157 10:108776370-108776392 GGCCAGAAGGAGAGAGTGGAGGG - Intergenic
1074222066 10:111447766-111447788 GGAGAGAGAGAGAGTATGCAGGG + Intergenic
1074496706 10:113985946-113985968 GGACAGAGAGAGAGGAAGGAAGG + Intergenic
1074695169 10:116044021-116044043 GGAGAGAGAGAGAGTGAGGGAGG - Intergenic
1074897711 10:117791464-117791486 GGTCAGAGGGAGACTGAAGAAGG - Intergenic
1075546118 10:123356129-123356151 GGAAAGAGAGAGAGTGGGGGCGG + Intergenic
1075808133 10:125204786-125204808 AGACAGTAGGAGAGTGGGGAGGG + Intergenic
1076242896 10:128923253-128923275 CGCCCGAGGGATAGTGTGGAGGG + Intergenic
1076383926 10:130044022-130044044 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1076757185 10:132578742-132578764 GGACACCAGGAGAGTGTGCAGGG + Intronic
1076790584 10:132774964-132774986 GGAGAGAGGGACAGGGAGGAGGG + Intronic
1076852829 10:133101452-133101474 GGACAGATGGAGAGGCTGCAGGG - Intronic
1076869894 10:133188102-133188124 GGACGCAGGGGCAGTGTGGATGG - Intronic
1076898975 10:133327847-133327869 GGACAGGAGGAGAAGGTGGAAGG - Intronic
1077121378 11:910520-910542 GGGTGGAGGGCGAGTGTGGACGG - Intronic
1077140197 11:1020871-1020893 GGAGAAAGGGAGAGAGGGGAGGG - Intronic
1077248289 11:1549574-1549596 GGACAGAGGGTGGGAGAGGAGGG - Intergenic
1077292421 11:1804114-1804136 GGACAGACGGCAGGTGTGGAGGG + Intergenic
1077383457 11:2258110-2258132 GGACTGAGGGAGAGTGGGAGAGG + Intergenic
1077392595 11:2307000-2307022 AGAAAGAGGGGGAGGGTGGAGGG + Intronic
1077474848 11:2781509-2781531 GGCCAGAGGGGGAGTGGGCAGGG - Intronic
1077500681 11:2908545-2908567 GGCCAGAGAGAGAGTGTGACTGG + Intronic
1077864377 11:6210769-6210791 GGAATGAGGGAGACTGGGGAGGG + Intronic
1077922591 11:6652881-6652903 GGAGAGAAGGAGAAAGTGGATGG - Intronic
1077956325 11:7023831-7023853 CGAGAGAGGGAGAGTAGGGAGGG + Intronic
1078108113 11:8371320-8371342 AGACAGAGGCAGAGACTGGAGGG + Intergenic
1078439319 11:11351079-11351101 GGACAGATGGAGTGTCTGGAAGG + Intronic
1078536129 11:12175892-12175914 GGCCAGAGAGAGAGTGGGGTTGG + Intronic
1078718419 11:13861121-13861143 GGAGAGAGGGAGAGAGCAGACGG - Intergenic
1078745916 11:14114180-14114202 GGACAGAAGGGAAGTGGGGATGG - Intronic
1078861591 11:15252932-15252954 GGACACAGGGAGATGGTGGTTGG - Intergenic
1079862606 11:25692838-25692860 GGACTGAGGGAAAGGGTGGAAGG - Intergenic
1079894862 11:26105677-26105699 GGAAAGAAGGAGAGGGTCGAGGG - Intergenic
1080678233 11:34447617-34447639 GTAGAGTGAGAGAGTGTGGATGG + Intronic
1080766554 11:35302712-35302734 GTACCGAGGGAGAGAATGGAAGG - Intronic
1080794065 11:35547268-35547290 GGGCAGAGGAAGAGTGAAGAAGG - Intergenic
1081181462 11:39990454-39990476 GGAGAGAGGGAGAGAGTACAAGG - Intergenic
1081567441 11:44268717-44268739 TGAGAGAGGGAGAGTGAGGAGGG + Intronic
1081687986 11:45056041-45056063 GGAGAGAGAGAGAGTGAGGGGGG + Intergenic
1081782493 11:45722812-45722834 GGCCAAAGGGAGAGCTTGGAGGG + Intergenic
1081963468 11:47155095-47155117 GGAGAGAGGGAGAGGGAGGAAGG - Intronic
1082084917 11:48042001-48042023 GGAGAGAGAGAGAGAGAGGAAGG + Intronic
1082986020 11:59172095-59172117 GGAGGGAGGGAGAGAGGGGAGGG + Intronic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083281657 11:61630423-61630445 GGACAGAGGCAGGGAGAGGACGG + Intergenic
1083486576 11:62986583-62986605 GGACAGTGAGAGAGAGTAGATGG + Intergenic
1083803666 11:65060936-65060958 GGGCAGGTGGAGAGTGGGGAGGG - Intergenic
1084068454 11:66718877-66718899 GGAGAGAGGCGGAGTGTGGCCGG + Intronic
1084425316 11:69081102-69081124 GGACAGAGGGTCTGTGTAGAAGG + Intronic
1084486713 11:69452399-69452421 GCAGTGAGGGAGAGTGTGGGAGG + Intergenic
1084563572 11:69917452-69917474 GGAGAAAGGGAGAGAGAGGAGGG - Intergenic
1084849786 11:71929352-71929374 GGACAGAGAGAGAGGTCGGAGGG + Intronic
1085082917 11:73648718-73648740 GGACAGAGGGCCAGGGAGGAGGG + Intronic
1085396655 11:76210054-76210076 CGACAGAGGGTGTGTGTGGTGGG - Intronic
1085428606 11:76426741-76426763 GGAGGGAGGGAGAGAGGGGAAGG + Intergenic
1085439281 11:76543634-76543656 GGACGGAAGGAGACTGAGGAGGG - Intronic
1085716987 11:78881253-78881275 GGATAGAGAGTGAGTGTGGAAGG - Intronic
1085875494 11:80402369-80402391 GGGAAGAGGGAGAATGTAGAGGG - Intergenic
1086177640 11:83911199-83911221 GGGCAGAGGCAGAGAGAGGAAGG + Intronic
1086304974 11:85470055-85470077 TGTCAGAGGAACAGTGTGGATGG - Intronic
1086669858 11:89532880-89532902 GGAGAGAGGAAGAGTGAGCAGGG - Intergenic
1087608100 11:100401738-100401760 GGAGAGAGGGAGAGAGAGGAGGG + Intergenic
1087939547 11:104078480-104078502 GGAAAGAGGGAGAGAGTGGTAGG - Intronic
1087954192 11:104264647-104264669 GGAAGAAGGAAGAGTGTGGAGGG - Intergenic
1088021081 11:105120266-105120288 GGACAGAGGTAGAGGGTCAAGGG + Intergenic
1088974162 11:114799969-114799991 AGAAAGAGGGAGAGGGAGGAGGG - Intergenic
1089100376 11:115958090-115958112 GGAGGGAGGGAGAGAGAGGAAGG - Intergenic
1089184597 11:116606309-116606331 GGACAGAGAGACAGTGGGGCTGG - Intergenic
1089294826 11:117461261-117461283 GGGCCGGGGGAGAGTGAGGAAGG - Intronic
1089345972 11:117792130-117792152 GGACAGAGGTAGAGAGGGGGAGG - Intronic
1089620629 11:119720263-119720285 GGACTGAGGGAGAAGGTGCATGG + Intronic
1090446393 11:126768298-126768320 GGACAGATGGACAGATTGGATGG - Intronic
1090662404 11:128891367-128891389 GGACGGAGGGAGAGAGGAGAGGG + Exonic
1090905397 11:131070179-131070201 GCATAGAGGGCCAGTGTGGAAGG + Intergenic
1090969598 11:131628907-131628929 GTACAGGCGGAGAGTGTGGCAGG + Intronic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091112882 11:132987060-132987082 GTGAAGAGGGAGAGCGTGGATGG - Intronic
1091137676 11:133206819-133206841 GGACATCGTGAGAGTGTGGAGGG - Intronic
1091497345 12:984142-984164 GGACAGAGGGAGGGGGAAGAGGG - Intronic
1091661807 12:2389834-2389856 GGACAGAGGGAGTGAAAGGAGGG - Intronic
1091690324 12:2591894-2591916 AGACAGAGGCAGAGATTGGAGGG - Intronic
1091776720 12:3189469-3189491 CTACAGAGGGAGAGGGTGCAGGG + Intronic
1092021609 12:5207240-5207262 TGACAGAGGGTGAGGGTGGGAGG + Intergenic
1092121107 12:6044504-6044526 GGACCAAAGGACAGTGTGGAAGG - Intronic
1092286400 12:7131304-7131326 GGACAGACGGAGAGGGAGGACGG + Intronic
1092721644 12:11447022-11447044 AGACAGAGAGAGAGAGAGGAAGG + Intronic
1092941061 12:13407633-13407655 AGACAGAGGCAGAGACTGGACGG - Intergenic
1093102645 12:15046394-15046416 GGAAAGAGGGAAAGAGAGGAAGG - Intergenic
1093665770 12:21811173-21811195 GGAAAGAGGGAGAGTGAAGGGGG - Intronic
1093841497 12:23907995-23908017 GGAGAGAGCAAGAGTGGGGATGG - Intronic
1094086006 12:26592266-26592288 GGGCAGAGGGGAAGTGGGGATGG + Intronic
1094106548 12:26817857-26817879 GGGCAGAGGGAGGGTGGGGGAGG + Intronic
1094230215 12:28094097-28094119 GGAAAGAGGGAGGGAGGGGAGGG - Intergenic
1094708784 12:32940708-32940730 AGAGAGAGAGAGAGAGTGGAGGG - Intergenic
1095400141 12:41804902-41804924 GGACAGTGGGACTGTGTAGAAGG - Intergenic
1095512528 12:42968522-42968544 GGACATAGAGAAAGTGTGGCTGG - Intergenic
1095590748 12:43900822-43900844 GAACAGAGAGAGAGAGAGGAAGG + Intronic
1095899624 12:47314441-47314463 GGACTGAGGGACAGGGTGAATGG - Intergenic
1095958777 12:47820711-47820733 GGAAAGAGGGGGGTTGTGGAGGG - Intronic
1095962101 12:47842103-47842125 GGCCAGAGGGAGAGCTGGGAAGG + Intronic
1095969690 12:47893028-47893050 GGAGAGAGGGAGAGGGTGCCAGG + Intronic
1096147134 12:49286384-49286406 AGACAGAGGGAGAGACTGGAGGG + Intergenic
1096183067 12:49561315-49561337 GAAGTGAGGGGGAGTGTGGAGGG + Intronic
1096229821 12:49890637-49890659 GGACAGACGCTGAGTGGGGATGG - Intronic
1096267492 12:50135249-50135271 GGAGGGAGGGAGAGAGGGGAGGG + Intronic
1096411011 12:51377181-51377203 GCACAGAGGGTGAGGCTGGAGGG - Exonic
1096481235 12:51942518-51942540 GGCCAGAGGGTGTGTGTGCATGG + Intergenic
1096565643 12:52475819-52475841 AGACAGAGGGTGAGAGAGGAGGG + Intergenic
1096806814 12:54146014-54146036 GGAAAGCGGGGGAATGTGGAAGG - Intergenic
1096907293 12:54947082-54947104 GGACTGAGGGGAAGGGTGGAAGG + Intergenic
1097168432 12:57098563-57098585 GGATGGAGTGAGAGTGTGGTGGG + Exonic
1097270622 12:57771942-57771964 GGGCAGAGGGAGAGAGAGGAGGG - Intronic
1097459934 12:59849047-59849069 AGAGAGAGAGAGAGTGGGGAAGG - Intergenic
1097943614 12:65341370-65341392 GGAGAGAGAGAGAGAGTAGAAGG + Intronic
1097955983 12:65485545-65485567 GGAGAGAGAGAGAGAGTGAAGGG + Intronic
1098071053 12:66675186-66675208 AGACAGAGAGAGAGGGTGGGTGG + Intronic
1098163758 12:67672612-67672634 AGACAGAGGGAGCTTGTGCAGGG + Intergenic
1098562339 12:71888692-71888714 GGAAAGAGAGAGAGCTTGGAAGG + Intronic
1098771409 12:74558454-74558476 GGAGAGAGGGAGATTGTGAAGGG + Intergenic
1099082332 12:78201016-78201038 AGAAAGAGAGAGAGTGGGGAGGG - Intronic
1099475473 12:83103485-83103507 GGAGAGAGTGAGAGTGAGGGAGG + Intronic
1100017981 12:90035183-90035205 AGAATGAGGGAGAGTGGGGAGGG + Intergenic
1100448020 12:94678967-94678989 GGTCAGAGGGCGTTTGTGGAAGG - Intergenic
1100795489 12:98177373-98177395 AGAGAGAGAGAGAGTGGGGAGGG - Intergenic
1101083094 12:101209005-101209027 GGAAAGGGGGTGGGTGTGGAAGG + Intronic
1101454813 12:104820061-104820083 GGACAGAAAGCCAGTGTGGAGGG - Intronic
1101674900 12:106908778-106908800 AGACAGAGAGAGAGGGGGGAAGG - Intergenic
1101984464 12:109434770-109434792 GGACGGAGGCAGAGATTGGAGGG - Intronic
1102168514 12:110824606-110824628 GGACGGAGGGAGGGAATGGAAGG + Intergenic
1102186548 12:110951904-110951926 AGACAGAGGGAGAGGGAGGGGGG + Intergenic
1102317861 12:111904600-111904622 GGACTGAGTGAGAGGGTGGTGGG + Intergenic
1102458820 12:113087577-113087599 GGAGAAAGGGAGAGGGTGGGGGG + Intronic
1102573253 12:113840516-113840538 GGACAGAGGATGGATGTGGAGGG - Intronic
1102598734 12:114012856-114012878 GGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1102638753 12:114347674-114347696 GGACAGAGGGAGATGGTGGCTGG - Intergenic
1102745262 12:115244056-115244078 GGAGAAAGGGAGAGAGAGGAAGG + Intergenic
1102749535 12:115280399-115280421 AGAGAGATTGAGAGTGTGGAAGG + Intergenic
1102766448 12:115437565-115437587 GGAGTTAGGGAGGGTGTGGATGG + Intergenic
1102984082 12:117264653-117264675 GGAGAGGGAGAGAGTGTAGAGGG - Intronic
1103206825 12:119136265-119136287 GGGCTGAGGGAGAATCTGGATGG + Intronic
1103870211 12:124085844-124085866 GGACACAGAGAGCTTGTGGATGG + Intronic
1104078946 12:125413500-125413522 GGACTGGGGAAGAGTGAGGATGG - Intronic
1104091513 12:125521611-125521633 GGCCAGAGGGTGAGGGTGGAGGG + Intronic
1104668812 12:130666830-130666852 GGAGGGAGGGAGAGAATGGAGGG + Intronic
1104788726 12:131468609-131468631 GGACAGAGGGAAGGTCAGGAGGG + Intergenic
1105384903 13:19920610-19920632 GGAGAGAAGGAGAGTCGGGAGGG + Intergenic
1105614195 13:21997682-21997704 GGACAGTGGGGAAGTGGGGATGG - Intergenic
1106453874 13:29909969-29909991 GGACAGAGGTAAAAAGTGGAGGG - Intergenic
1106540975 13:30690027-30690049 GGAACGAGGCAGAGTGTGGCTGG + Intergenic
1106593387 13:31116934-31116956 GGGCAGAGGGAGAGGGAGGAGGG + Intergenic
1106763839 13:32894065-32894087 GGACAGAGGCAGAGAGAGGAAGG - Intergenic
1106794158 13:33187196-33187218 TGACAGAGGGAGAGGGTTGCCGG + Intronic
1107230868 13:38108709-38108731 AGCAAGAGGGAGAGTGAGGAAGG + Intergenic
1107318523 13:39160706-39160728 GGAGAGAGGGAGAGGAAGGAAGG + Intergenic
1107543281 13:41413223-41413245 GGACAGAGGGTGAATGTGAAGGG + Intergenic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1107708202 13:43127609-43127631 AGACAGAGGGAGAGGGAGGAGGG - Intergenic
1107727972 13:43319012-43319034 GGAGAGAGGGAGAGAGAGGGAGG + Intronic
1108288226 13:48929805-48929827 AGATATAGGGAGAGTGTGGGAGG - Intergenic
1108485635 13:50921352-50921374 AGAAAGAGGGAGTGTGAGGAAGG - Intronic
1109438950 13:62343842-62343864 GGACAAACGGAGAGTGAGTAAGG - Intergenic
1109470086 13:62792390-62792412 AGACAGAGGCAGAGACTGGAGGG + Intergenic
1109782374 13:67128594-67128616 TGACAGAGGGAGAGAGCAGAAGG - Intronic
1110550892 13:76810268-76810290 GGAGAGAGAGAGAGTGAAGAGGG - Intergenic
1110660650 13:78056352-78056374 GTAAAGAGGGAGAGTGTAGAAGG + Intergenic
1111318495 13:86592764-86592786 GGAGAGAGAGAGAGTGTGAAAGG + Intergenic
1111319914 13:86613746-86613768 GGACAGAGGGAGAGAATGTTTGG - Intergenic
1111669177 13:91306526-91306548 GGAGAGAGGGAGAGTGAAGGGGG - Intergenic
1111906998 13:94266532-94266554 AGACTGAGGGAGGGTGGGGAAGG - Intronic
1111974552 13:94951901-94951923 GGCCAGAGTCAGAGTGGGGAGGG + Intergenic
1112397825 13:99049482-99049504 GGACTGAGGGAGTGTGTTAAAGG + Intronic
1112451093 13:99510289-99510311 GGAAACAGGCAGAGTTTGGAGGG - Intronic
1112595717 13:100805153-100805175 GGATCCAGGGAGAGTGAGGAGGG + Intergenic
1113346493 13:109483057-109483079 GGACAGAGGAGGAGCGGGGAAGG - Intergenic
1113351366 13:109532575-109532597 GGAGAGAGAGAGAGTGAGGAGGG + Intergenic
1113464891 13:110506169-110506191 TGAGAGAGAGAGAGAGTGGACGG - Intronic
1113464904 13:110506251-110506273 AGAGAGAGAGAGAGAGTGGACGG - Intronic
1113464911 13:110506300-110506322 AGAGAGAGAGAGAGAGTGGACGG - Intronic
1113531662 13:111031973-111031995 GGTCAGCTGGGGAGTGTGGAGGG + Intergenic
1113695236 13:112341566-112341588 GGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1115901571 14:38156834-38156856 GGAGAGAGAGAGAGAGAGGAGGG + Intergenic
1117590945 14:57268329-57268351 GGCAAGAGGGAAAGTCTGGAAGG - Intronic
1118137693 14:63046333-63046355 CGAGAGAGGGGGAGTGAGGAGGG + Intronic
1118164412 14:63321860-63321882 AGTCAGAGAGAGAGTGCGGAAGG + Intergenic
1118229939 14:63938471-63938493 GGACAGAGTGACAGTGGAGAAGG + Intronic
1118647749 14:67856174-67856196 GGAGAGAGGAAGAGTAGGGATGG - Intronic
1118811178 14:69275157-69275179 GGACTGGGGCAGAGTTTGGAAGG + Intronic
1118925010 14:70184236-70184258 GGAAAGTGGGAGAGAGAGGAAGG - Intronic
1118975991 14:70677105-70677127 GCAGAGAGGGGGAATGTGGAAGG - Intergenic
1119324898 14:73753980-73754002 GGCCAGAGGGAGGCTGAGGAAGG + Intronic
1119443856 14:74647742-74647764 AGACAGAGGGAGAGGGAGGCAGG - Intergenic
1119963776 14:78889979-78890001 AGACAGAGGCAGAGATTGGAGGG + Intronic
1120210904 14:81632778-81632800 GGACAGAGAGAGAGAGTAAAGGG - Intergenic
1120598113 14:86465581-86465603 GGAGGGAGGGAGAGGGAGGAAGG + Intergenic
1120693912 14:87622703-87622725 GGAGACAGGGAGAGAGTGAAGGG + Intergenic
1120791769 14:88590549-88590571 GAAAAGAGGGAGTGTGGGGATGG - Intronic
1120974443 14:90236272-90236294 AGAAAGAGAGAGAGAGTGGAGGG - Intergenic
1121031090 14:90659306-90659328 GGAGAAAGGGAGAATGGGGAAGG + Intronic
1121481394 14:94278574-94278596 GAAGAGAGGGAGGGTGGGGAAGG - Intronic
1121512657 14:94523755-94523777 CGACAGAGGCAGAGATTGGACGG - Intergenic
1121702853 14:95969030-95969052 GGCCAGAGGGAGGGGGTGGTGGG - Intergenic
1121800181 14:96768598-96768620 GGAGGGAGGGAGAGAGAGGAAGG - Intergenic
1121852776 14:97237145-97237167 GGAAAAAGGGGGAGTGAGGAAGG + Intergenic
1122232996 14:100316379-100316401 GGACAGAGCCAGGGTGTGGTGGG + Intergenic
1122461196 14:101897098-101897120 GGCTGGAGGGAGAGTGTGCAGGG - Intronic
1122738889 14:103859497-103859519 GGAGGGAGGGAGCGAGTGGAGGG + Intergenic
1122785715 14:104162512-104162534 GGCCAGAGGGAGATTGAGGCTGG - Intronic
1122822512 14:104354693-104354715 GGGCAGGGGGAGTGGGTGGAGGG + Intergenic
1122865688 14:104603044-104603066 GGACAGCGGCAGAGGGTGGTGGG + Intronic
1122913558 14:104845398-104845420 GGACATGGGGAGAGGGTGGTGGG - Intergenic
1123213985 14:106789248-106789270 GGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1123448489 15:20345870-20345892 GGACATGGGGAGAGAGAGGATGG + Intergenic
1123910233 15:24958589-24958611 GGCCAGAGAGAGACTGAGGAGGG - Intronic
1124658766 15:31528392-31528414 GGAGAGAGGGAGAGTGAAAAGGG + Intronic
1124798562 15:32806875-32806897 GGGTAGAGGGTGTGTGTGGAGGG - Intronic
1125098136 15:35878284-35878306 GGAGAGAGGAAGAGTGTGGCAGG - Intergenic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125778599 15:42242530-42242552 GGAGAGAGGGAGAGGGAGGGAGG + Intronic
1125832654 15:42727775-42727797 GGGCAGAGGGAGAATGGGAAAGG + Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126178741 15:45764539-45764561 GGACAGAGGGAGAAGTTGAATGG + Intergenic
1126227652 15:46289861-46289883 GGGAAGAGGGAGGGTGTGGGTGG + Intergenic
1126418699 15:48447665-48447687 TGAGAGAGAGAGAGAGTGGAAGG + Intronic
1126454769 15:48849228-48849250 GGAGAGAGGGAGAGAGAGCAGGG - Intronic
1126568971 15:50129452-50129474 TGATAGAGGGAGAGTGTGGAGGG - Intronic
1127719237 15:61683480-61683502 TGAAAAATGGAGAGTGTGGAAGG - Intergenic
1128062900 15:64746562-64746584 GGACAGCTGCAGAGTGTGGATGG + Intronic
1128122404 15:65162152-65162174 GGTCCGATGGAGGGTGTGGAAGG - Intronic
1128213064 15:65915763-65915785 GGACAGAGGAGGAGTGAGCAGGG + Intronic
1128511013 15:68313930-68313952 GGTCTGAGGCAGACTGTGGAAGG + Intronic
1128666568 15:69542517-69542539 GGGCAGAGCGAGAGGGTGGAAGG + Intergenic
1128677979 15:69625799-69625821 GGATGGAGGGAGAGAGAGGAAGG - Intergenic
1128677988 15:69625829-69625851 GGATGGAGGGAGAGAGAGGAAGG - Intergenic
1128756663 15:70187930-70187952 TGACAGGGCGAGAGTGTGGCAGG - Intergenic
1128812765 15:70584674-70584696 GGCCAGAGGGGAAGTGTGGGAGG + Intergenic
1128834111 15:70795231-70795253 GGGCTGAGGGAGGGTGGGGATGG + Intergenic
1129118974 15:73383520-73383542 TGACAGAGAGGGAGGGTGGAAGG - Intergenic
1129306427 15:74667449-74667471 GGGGAGAGGGAGGGGGTGGAGGG + Intronic
1129389809 15:75214866-75214888 GGACAAAGGCAGGGTGTGGGAGG - Intergenic
1129933085 15:79428379-79428401 GGAGAGAGGGAGAGGAGGGAGGG - Intergenic
1130212948 15:81942967-81942989 GGAGGGAGGGAGAGAATGGATGG + Intergenic
1130449179 15:84033756-84033778 TGACAGAAGGACAGTGTGGCTGG - Intronic
1131055516 15:89372174-89372196 GGACAAATGGATGGTGTGGAAGG + Intergenic
1131641538 15:94298910-94298932 GGAAAGAGGGAGAGGGAGGGAGG - Intronic
1131818360 15:96246152-96246174 AGACAGAGGGATGGAGTGGATGG + Intergenic
1132255759 15:100374154-100374176 GGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1132270304 15:100518342-100518364 GGACAGAGAGAGAGAGAGCATGG + Intronic
1132421773 15:101676154-101676176 GGGCAGAGGGGCAGTGTGGTAGG + Intronic
1132592253 16:731144-731166 GAACGGAGAGAGAGGGTGGAAGG + Intronic
1132753775 16:1471949-1471971 GGACAGAGGGAGTGTGTGTTTGG - Intronic
1132843244 16:1988683-1988705 GGTCAGAGGGAGAGAGAGGAGGG + Intergenic
1132995210 16:2819151-2819173 GGCCAGAAGGAGAGTGTGAGAGG + Intronic
1133215611 16:4290528-4290550 GGCCAGAGAGAGAGGGTGCAGGG - Intergenic
1133392585 16:5422179-5422201 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1133439380 16:5807676-5807698 TGAGAGAGAGGGAGTGTGGAAGG + Intergenic
1133475435 16:6116837-6116859 AGACAGAGGGAGAGAGAGGCTGG + Intronic
1133589557 16:7229576-7229598 GGAGAAAGGGAGAGAGAGGAAGG + Intronic
1133870033 16:9677473-9677495 GGAGAGAGAGAGAGTGGGGAGGG + Intergenic
1133975481 16:10597300-10597322 TGACAGAGAGAGAGTGGTGAGGG + Intergenic
1134012753 16:10867407-10867429 AGACAGAGGGAGAGCGAGAAAGG + Intergenic
1134095710 16:11417111-11417133 GGACAGAGGGTGAGGGGGGGTGG - Intronic
1134122780 16:11596649-11596671 GGGGAGAGGGAGGATGTGGAGGG + Intronic
1134316934 16:13127295-13127317 GGAGAGAGAGAGAGTGAGGGAGG + Intronic
1134449255 16:14353845-14353867 GGAGAAAGGGAGAGGGAGGAAGG + Intergenic
1134468397 16:14499337-14499359 GGACAGAGAGAGGAAGTGGAAGG + Intronic
1134656915 16:15954356-15954378 GGAGAGAGGAAGGGTCTGGAAGG - Intronic
1135052877 16:19206701-19206723 GGACAGAGGTGGAGGCTGGAGGG - Intronic
1135128569 16:19832827-19832849 GGAGAGAGAGAGAGTGAGGGGGG + Intronic
1135163698 16:20120159-20120181 GGAGGGAGGGAGAGGGAGGAAGG - Intergenic
1135165813 16:20138226-20138248 GAAGAGAGGGAGAGTGAGAAGGG - Intergenic
1135197019 16:20403111-20403133 GCACACAGGGAGAATGTGGAGGG - Intronic
1135276914 16:21121103-21121125 GGAGAGAGTGAGAAGGTGGAAGG + Intronic
1135295747 16:21278068-21278090 GCACAGGGGGTGAGTGAGGAGGG - Exonic
1135325922 16:21525844-21525866 GGACACAGGGAGACCGTGGTTGG + Intergenic
1135487570 16:22879464-22879486 GGATAAAGGCAGAGGGTGGATGG + Intronic
1135866810 16:26110810-26110832 TGAGAGAGGGAGACAGTGGAAGG - Intronic
1135941412 16:26825359-26825381 GGAGAGAGGGAGAGAGGGAATGG - Intergenic
1136295678 16:29300824-29300846 AGACAGAGTGAGTGTGTGGGAGG + Intergenic
1137382346 16:48011158-48011180 GGAGAGAGGGAGAGAGAGAAGGG + Intergenic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1137704215 16:50522920-50522942 GGAGGGAGAGAGAGTGGGGATGG - Intergenic
1137743023 16:50799322-50799344 GGAGAGGGAGAGAGTGGGGAAGG + Exonic
1137792359 16:51185617-51185639 GGACAGAGGGAAACAGAGGAGGG + Intergenic
1137921199 16:52490210-52490232 GGAGAGAGGGAGAGAGTGAAGGG - Intronic
1138358583 16:56406092-56406114 GGAGAGGGGGAGAGGGGGGAGGG + Intronic
1138420770 16:56897758-56897780 GGACAGAGGGAGGCAGAGGAAGG - Intronic
1138439743 16:57026862-57026884 GGTCAGTGGGAAATTGTGGAAGG - Exonic
1138575179 16:57903132-57903154 GGAAGGAGGGAGAGAGAGGAAGG + Intronic
1138962989 16:62050084-62050106 GAACAGAGAGAGGGTGTGGAGGG + Intergenic
1139340134 16:66263047-66263069 AGACAGAGGCAGAGATTGGAGGG - Intergenic
1139351400 16:66338468-66338490 AGAAAGAGGGAGAGTGGGGGAGG + Intergenic
1139374712 16:66489734-66489756 GCACAGAGGCAGAGGCTGGAGGG + Intronic
1139547697 16:67657375-67657397 GGAGGGAGGGAGAGAGAGGAAGG - Intronic
1139578553 16:67857861-67857883 GGACAGAAGGTGTGGGTGGAGGG + Intronic
1139939008 16:70591370-70591392 GGACAGAGGGTGACTCTGGCAGG + Intronic
1139953130 16:70681454-70681476 GGGCAGAGGCACAGTGTGGAGGG + Intronic
1140236663 16:73165422-73165444 GGGCCCAGGCAGAGTGTGGATGG - Intergenic
1140697762 16:77551817-77551839 GAAGAGAGGGAGAGGGTGGGAGG + Intergenic
1140914698 16:79483161-79483183 GGAGAGAGGGAGGGGATGGAGGG - Intergenic
1140914707 16:79483183-79483205 GGACAGAAGGAGGGAGGGGAGGG - Intergenic
1141028872 16:80570930-80570952 GGATGGAGGGAGAGTGGGGTGGG - Intergenic
1141278368 16:82608089-82608111 GGCCAGAGGGCTAGTGTGGGAGG + Intergenic
1141502186 16:84451894-84451916 GGAGAGAGGGGGAGTAAGGAGGG - Intronic
1141610573 16:85178844-85178866 GGACTGAGGGACGGTGAGGAGGG + Intronic
1141713480 16:85713859-85713881 GGACAGTGGGAGACTGTGCCTGG + Intronic
1141778854 16:86143235-86143257 GGACAGAGGGACTGGGAGGAGGG + Intergenic
1141788711 16:86218534-86218556 AGACAGAGGCAGAGGTTGGAGGG + Intergenic
1141886277 16:86894535-86894557 GCACAGAGGGAGAGGGTCGGGGG - Intergenic
1141935023 16:87232570-87232592 GCACAGTGGGGAAGTGTGGAAGG + Intronic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142038955 16:87880535-87880557 GGACACAGGGAGACCGTGGTTGG + Intergenic
1142073576 16:88104513-88104535 GGACTGAAGCAGAGTGTGGCTGG - Intronic
1142101592 16:88275011-88275033 AGACAGAGTGAGTGTGTGGGAGG + Intergenic
1142413774 16:89930055-89930077 GGAAAGAGAGAGAGAGAGGAAGG - Intronic
1142918912 17:3167307-3167329 GGAAAGAGAGAGAGAGAGGAGGG - Intergenic
1143008264 17:3851303-3851325 GGAGAGAGGGAGAATGGAGAAGG - Intergenic
1143126650 17:4645709-4645731 AGAAAGAGGGAGAGTGGGGAGGG - Intergenic
1143246300 17:5488307-5488329 GAACAGAAAGAGAGGGTGGAGGG + Exonic
1143483131 17:7238505-7238527 GGAGAGAGAGAGAGAGTGGCTGG - Intronic
1143624288 17:8100126-8100148 GGAGGGAGGGAGAGGGGGGAGGG + Intronic
1143805693 17:9424364-9424386 GGCCTGAGGGAGAGGGTTGAAGG - Intronic
1143889839 17:10094402-10094424 GGACAGAGGTAGGCAGTGGAAGG - Intronic
1143890570 17:10099207-10099229 GGGCAGAGGGAGGGTTTGGATGG - Intronic
1143993099 17:10983798-10983820 GGACACAGGGAGTGGATGGATGG + Intergenic
1144100888 17:11941331-11941353 GGACAGAGGGAGAGAGGGGAAGG - Intronic
1144954560 17:19012563-19012585 GGACAGACGGAGAATGGGGTGGG + Intronic
1145416658 17:22718881-22718903 GAGCAGAGGGAGTGTGTGGCTGG - Intergenic
1145786242 17:27595688-27595710 GGGCAAAGGGAGAATGTGGGGGG - Intronic
1145815615 17:27793184-27793206 GGACAGATGGGGAGGGTGGGGGG + Intronic
1145961053 17:28886755-28886777 GGACAGAGGCCGAGGGTGAAGGG + Intronic
1146178062 17:30679471-30679493 GGACAGAGGGGGAGGATGGGGGG + Intergenic
1146185464 17:30721385-30721407 GGACACACAGAGAGTGAGGAGGG - Intergenic
1146466630 17:33091316-33091338 GGAAGAAGGGTGAGTGTGGAGGG + Intronic
1146499844 17:33354848-33354870 GGACAGAGGCAGAGGGGAGAGGG - Intronic
1146804262 17:35852641-35852663 GGTTTGAGGGAGAGAGTGGAGGG + Intronic
1146946818 17:36878823-36878845 GGACAGAGAGAGAGAGAGGGAGG - Intergenic
1147239292 17:39080030-39080052 TGACAGAAGGAGAGTGTGGCTGG - Intronic
1147252093 17:39158811-39158833 GGAGAGTGGAAGTGTGTGGAGGG - Intronic
1147398221 17:40161885-40161907 GGAGAGAGGCAAAGTGGGGACGG + Exonic
1147495571 17:40912048-40912070 TGACTGAGAGACAGTGTGGATGG + Intergenic
1147656814 17:42095784-42095806 GGGGACAGGGAGAGTGGGGAAGG + Intergenic
1147717905 17:42520510-42520532 GGAAAGAGGGGGAGTTAGGAGGG - Intronic
1148018076 17:44536573-44536595 GGACAGAGGGAGAATGAGCCAGG - Intergenic
1148131039 17:45262698-45262720 GGACAGGAGGGGAGGGTGGAGGG + Intergenic
1148404694 17:47400623-47400645 GGAGGGAGGGAGAGTGGGAAGGG - Intronic
1148554263 17:48568731-48568753 GGACAGAGGGAGAGAGGGAGAGG + Intronic
1148554267 17:48568739-48568761 GGAGAGAGGGAGAGGGAGGGAGG + Intronic
1148628442 17:49088325-49088347 GGAGAGAGGGAGAGGGAGGGAGG + Intergenic
1148724580 17:49779469-49779491 GGACAAAGGGGCAGGGTGGAGGG + Intronic
1148759264 17:49991138-49991160 GGGATGGGGGAGAGTGTGGAGGG - Exonic
1148759980 17:49994630-49994652 GGACAGTGGGAGACACTGGAAGG - Intronic
1148783064 17:50132375-50132397 GGACAGACGGGGAGTGGGGGAGG + Intergenic
1148805952 17:50264169-50264191 AGAGGGAGGGAGAGTGGGGAAGG + Intergenic
1149159153 17:53668952-53668974 GGGGGGAGGGAGAGTGGGGAAGG + Intergenic
1149386861 17:56150999-56151021 GGACAGAGTGAGAGGCAGGATGG + Intronic
1149502695 17:57166509-57166531 GGAAAGAGGAGGAGTGGGGAGGG + Intergenic
1150004694 17:61462530-61462552 GGGCATAGGGAGAGGGTGCAGGG + Intronic
1150337857 17:64343363-64343385 GCACAGAGGGAGAGTGAGTGTGG - Intronic
1150343744 17:64388326-64388348 GGACAAAGGGAGAGTGGGTAGGG + Intronic
1150456256 17:65309064-65309086 GGACCCAGGGACAGAGTGGAGGG - Intergenic
1150991418 17:70264241-70264263 GGAGAGAGAGAGAGGGGGGAAGG - Intergenic
1151454577 17:74218281-74218303 GGACAGGGTGAGAGGGTGTAGGG - Intronic
1151700787 17:75741440-75741462 GGAGAGAGAGGGAGTGAGGAGGG + Intronic
1151852748 17:76700804-76700826 GGAGAGAGAGAGAGAGTGGGCGG + Intronic
1152253988 17:79226837-79226859 GGAAAGAGGGAGCGTGAGGCTGG + Intronic
1152274196 17:79344873-79344895 GGACAGAGGCAGATTGGGGTGGG - Intronic
1152285722 17:79411557-79411579 GCACAGAGGGAGGGCATGGAAGG - Intronic
1152288576 17:79425993-79426015 GGAATCACGGAGAGTGTGGAGGG + Intronic
1152299569 17:79487140-79487162 GGACAGGGGAAGATTGAGGAGGG + Intronic
1152307478 17:79529727-79529749 GGAAGGAGGGAGAGTGAGGAAGG + Intergenic
1152328746 17:79658291-79658313 GGAGAGAGGGAGAGAGGGAAGGG - Intergenic
1152650760 17:81491615-81491637 GGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1152726981 17:81952328-81952350 GGAGAGAGGGAGGGAGAGGAGGG + Intergenic
1153682896 18:7517296-7517318 GGACAGGGGAGGAGTGTGCAGGG + Intergenic
1153748610 18:8206916-8206938 GGACAGAGGCAGAGATTGGAGGG + Intronic
1153749033 18:8210390-8210412 GGACAGAGGCAGAGATTGGAGGG + Intronic
1153819710 18:8823090-8823112 GGACATGGGGACAGTGGGGAGGG - Intronic
1153950487 18:10054107-10054129 GGACAGGGTGAGAGTGGAGATGG + Intergenic
1154355300 18:13619949-13619971 GGACTGAGGGTGGGAGTGGAGGG - Intronic
1155073438 18:22335893-22335915 GGAGAGTGGGAGGGTGAGGAGGG + Intergenic
1155194285 18:23458613-23458635 GGACAGAGCAAGATTATGGAGGG + Intronic
1155546256 18:26919025-26919047 GGCAAGAGGGAGAGTGTGCAGGG + Intronic
1155587445 18:27383486-27383508 GGAAAGAGGGAGATTGGAGAAGG - Intergenic
1155760565 18:29560036-29560058 AGACAGAGGCAGGGTATGGAGGG + Intergenic
1155941043 18:31802388-31802410 GGTGAGGGGGAGAATGTGGAGGG - Intergenic
1156372681 18:36485391-36485413 GGAGGGAGGGAGAGTGAGCATGG + Intronic
1156812052 18:41264212-41264234 GGACAGTGGGTGGGTGGGGAGGG + Intergenic
1156924944 18:42564663-42564685 GGAGAGAGAGAGAGAGTGCAGGG - Intergenic
1156985057 18:43341307-43341329 GGAGAGAGGGAGAAGGGGGAAGG + Intergenic
1157002917 18:43549044-43549066 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1157021208 18:43784407-43784429 GCACAGAGGCAGAGGGTGGTGGG + Intergenic
1157110839 18:44818825-44818847 TCACAGAGGGAGATGGTGGAAGG - Intronic
1157283358 18:46360554-46360576 AGAGAGAGGGAAAGTCTGGAAGG - Intronic
1157312197 18:46560688-46560710 GGAGAGAGGGAGGTGGTGGAAGG - Intronic
1157478625 18:48038770-48038792 GGACAGTGGCAGGGTGGGGAAGG + Intronic
1157701420 18:49763332-49763354 GGACTGAGGGAGAGTTAGGGAGG - Intergenic
1157891382 18:51421425-51421447 GGAGAGAGAGAGAGAGTGCAAGG + Intergenic
1157899439 18:51500353-51500375 GAACAAGGTGAGAGTGTGGAGGG + Intergenic
1158725198 18:59964942-59964964 GGAAAGAGGGACAGTGTAGAGGG - Intergenic
1158958543 18:62566576-62566598 AGACAGAGTGAGCTTGTGGAGGG - Intronic
1159371041 18:67528138-67528160 AGACAGAGGGAGAAACTGGAGGG + Intergenic
1159653146 18:71000705-71000727 GGAGAGAGGGAGAGGGAGGGAGG + Intergenic
1159892456 18:73965469-73965491 GGAAAGAGAGAGAGAGTGAAGGG + Intergenic
1160105472 18:75970501-75970523 GTACAGAGGGAGGGTGTGAGAGG - Intergenic
1160183950 18:76660422-76660444 GGGCAGATGGAGTGTTTGGAGGG - Intergenic
1160367083 18:78335530-78335552 GGAGAGAGGGAGAAGGAGGAGGG + Intergenic
1160448669 18:78947104-78947126 GGAGAGAGGAAGAGGATGGAGGG + Intergenic
1160681602 19:413937-413959 AGACAGAGGTGGAGTGTGGATGG + Intergenic
1160872149 19:1282416-1282438 GGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1160930053 19:1566338-1566360 GGACCGAGGGAAAGGGCGGAGGG + Intronic
1160951578 19:1670059-1670081 GGAAAGAGAGAGAGAGGGGAGGG - Intergenic
1161204041 19:3031165-3031187 AGACAGAGGAAGAGTTTAGAGGG + Intronic
1161255982 19:3310008-3310030 GGAAAGAGGGAGAGGGAGAAAGG - Intergenic
1161442607 19:4300820-4300842 GGACAGGGAGAGAGGGAGGAAGG + Intronic
1161644676 19:5445723-5445745 GGACAGAGGAGGAGGGAGGAGGG + Intergenic
1161684837 19:5697583-5697605 GAAGAGAGGGAGAGAGAGGAGGG + Intronic
1161731070 19:5960913-5960935 AGACAGAGGGAGGCTATGGAAGG + Intronic
1161768337 19:6218709-6218731 GGACAGAGGGTGACAGTGCAGGG + Intronic
1161790746 19:6358349-6358371 AGACAGAGGGAGGGAGTTGAAGG - Intergenic
1161845571 19:6710100-6710122 AGAGAGAGGGAGAGTGAGGGGGG + Intronic
1161856993 19:6771840-6771862 GGAAAGAGGGAGAGAAAGGAAGG + Intergenic
1161938309 19:7385959-7385981 GGAGAGAGGGAGAGAGGGGGAGG - Intronic
1162040075 19:7965583-7965605 GGAGGGCGGGAGAGTCTGGAGGG - Intronic
1162310101 19:9901072-9901094 GGAAAGAAAGAGAGTGAGGAAGG + Intronic
1162417605 19:10547357-10547379 GGGCAGAGGGACACTGGGGAAGG + Intronic
1162735558 19:12745256-12745278 GGCCAGAGGGAGCCTGTGGTGGG - Intronic
1162780051 19:13002236-13002258 GGAGAGAGGGAGCGGGAGGAGGG - Intronic
1162968010 19:14164929-14164951 GGGCACAGGGCGAGGGTGGAGGG + Intronic
1162973312 19:14194311-14194333 GGACACAAAGAGAGTGAGGAGGG + Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163073833 19:14870169-14870191 GGTAAGAAGGAGAATGTGGATGG + Intergenic
1163182500 19:15614577-15614599 GGACAGAGGGGGCCTGTGAAGGG - Intergenic
1163207225 19:15812553-15812575 GGAAAGGAGGAGAGTGAGGAAGG + Intergenic
1163207240 19:15812618-15812640 GGAAAGAAGGAGAGTGAGGAAGG + Intergenic
1163825225 19:19519761-19519783 GGACAGAGGGAGAGGAGGCAGGG - Intronic
1163826981 19:19529338-19529360 GGAGAGATGGAGAGTGGGGGTGG - Intronic
1163847312 19:19645126-19645148 GGACAGAGGGTCACTGAGGAAGG - Intergenic
1164305511 19:24002070-24002092 GCACAGTGGGCGAGAGTGGACGG + Intergenic
1164398655 19:27887926-27887948 GGAAGGAGAGAGAGAGTGGAGGG - Intergenic
1164426023 19:28142598-28142620 GGAAAGAGGGAAAGAGAGGAAGG + Intergenic
1164508632 19:28879484-28879506 GGAGAGAGGGAGTGCGTGGATGG - Intergenic
1164521634 19:28984133-28984155 TCCCAGGGGGAGAGTGTGGATGG + Intergenic
1164592145 19:29512943-29512965 GGAGAGAGGGATGGTGAGGAAGG + Intergenic
1164857636 19:31537346-31537368 GGACAGAGAGAGAAAGTGTATGG - Intergenic
1165121599 19:33562582-33562604 GGCCAGAGGGAGAGTGGCGGGGG + Intergenic
1165426799 19:35750351-35750373 AGACAGAGTGAGGGTGGGGAAGG - Intronic
1165476944 19:36036124-36036146 GCACAGAGGGACAGTGGGGCAGG - Intronic
1165749413 19:38251162-38251184 GGAGAGAGGGAGGTTGTGGGGGG + Intronic
1165758694 19:38308504-38308526 TGACAGAGGGAGGATGAGGATGG + Intronic
1165782346 19:38441802-38441824 GGACGGTGGGAGACTGAGGAGGG + Intronic
1165896888 19:39146880-39146902 GGAGGGAGGGAGAGGGGGGAAGG + Intronic
1166214266 19:41325370-41325392 GGACAGAGGGACAGAGTGACTGG - Intronic
1166394474 19:42428781-42428803 GTACAGTGGGAGAGTGAGGTGGG + Exonic
1166554252 19:43687766-43687788 GGACAAAGGCAGTGGGTGGAAGG + Intergenic
1166680611 19:44764117-44764139 GGAAAGAGGGAGAGGAAGGAAGG + Intergenic
1166799225 19:45445716-45445738 GGACAGAGAGAACGTGGGGAGGG + Intronic
1166811553 19:45517570-45517592 GGACAAAGACAGTGTGTGGAAGG - Intronic
1166880890 19:45929348-45929370 GGGCAGAGGGACAGAGAGGAGGG + Intergenic
1167104424 19:47421869-47421891 GGAGAGAGGGAGAGGAAGGAGGG - Intergenic
1167295334 19:48646198-48646220 GGAGAGAGGGAGGGGGAGGAGGG - Exonic
1167350141 19:48969259-48969281 GGACAGGCGGGGAGTGTGGTGGG + Exonic
1167487203 19:49769598-49769620 GGAGAGAGGGCGGGTGTGGAGGG + Intronic
1167605409 19:50479189-50479211 GGACAGAGGCTGAGAGTGGCAGG - Intronic
1167618613 19:50549400-50549422 GGAGAGGGGGAGGGAGTGGAGGG - Intronic
1167721442 19:51182813-51182835 GGAGGGAGGGAGAGTGTGGGTGG + Intergenic
1167763534 19:51463957-51463979 GGAGGGAGGGAGAGTGTGGGTGG - Intergenic
1167799356 19:51730162-51730184 AGACAGAGGGAGAGGGAGGGAGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1168099545 19:54133939-54133961 GGAGGGAGGGAGAGAGGGGAAGG - Intergenic
1168161574 19:54513526-54513548 GGAGAGAGGGAAAGTGGGAAGGG + Intergenic
1168205839 19:54850529-54850551 AGAGGGAGGGAGAGTGGGGATGG + Intronic
1168562448 19:57395560-57395582 GGAGAGAGGGAGAGAATGAAGGG + Intronic
1168720795 19:58554031-58554053 GGCCAGATGGTGAGTGTGGGTGG - Exonic
925169306 2:1741100-1741122 GGACAGGAGGAGGGCGTGGAGGG + Intronic
925220456 2:2135305-2135327 GGAAAGAGAGAGAGTGTGCAGGG - Intronic
925293817 2:2765177-2765199 GGACACAGGGAGAGAGAGGCTGG + Intergenic
925356736 2:3246952-3246974 GGAGACAGGGAGAGAGGGGAAGG + Intronic
925507610 2:4585344-4585366 GGAGGGAGGGAGAGAGGGGAGGG - Intergenic
925524941 2:4788959-4788981 AGAGAGAGAGAGAGTGAGGAGGG + Intergenic
925916230 2:8608406-8608428 GGACAGAGGGCCAGTGTTGGTGG - Intergenic
926043485 2:9692974-9692996 GGGCCGAGGTGGAGTGTGGAGGG - Intergenic
926530129 2:14033945-14033967 GGAAAGAGGTAGAGTGGAGATGG + Intergenic
926601888 2:14854384-14854406 GGACATGGGGAGAGGGTTGATGG - Intergenic
926645008 2:15281158-15281180 GAACAGAGTGAGAATGTTGAAGG + Intronic
926705497 2:15834612-15834634 GCAAAGAGGGAGCGTGTGAAAGG + Intergenic
926742001 2:16119459-16119481 GGAGAGAGAGAGAGTGAGTAGGG - Intergenic
926913441 2:17872209-17872231 GGAGAGAGGGAGAGAGAGGAAGG - Intergenic
927088177 2:19690542-19690564 GGAGAGAGGGAGAGAGAGGGAGG + Intergenic
927242793 2:20933152-20933174 GGGGAGAGGGGGAGTGTGGCAGG + Intergenic
927667896 2:25044811-25044833 GGGCAGAGGCAGGGTGAGGAGGG - Intronic
927809463 2:26173396-26173418 GGCCAGAGGGATCGTGAGGAGGG + Intronic
928278344 2:29921811-29921833 GAACAGAGGGAGGGTGGGGCGGG - Intergenic
928392845 2:30922492-30922514 GGACAGTGGGAGAGTAGGGTTGG - Intronic
928419928 2:31130456-31130478 GGACAGAAGAAGAATGTGAAGGG + Intronic
928851457 2:35752642-35752664 GGATAGTGGGAAAGTGGGGATGG - Intergenic
929046843 2:37798641-37798663 GGAAAAAGGCAGAGGGTGGAAGG - Intergenic
929236980 2:39615891-39615913 GGAGAGCAGGAGAGTGGGGAGGG - Intergenic
929449168 2:42025261-42025283 GGAGAGAGGGAGAGTGAGCTAGG + Intergenic
929973662 2:46609694-46609716 AGAGAGAGGGAGGGTGGGGAAGG + Intronic
930046503 2:47177003-47177025 GGAAAGTGGGTGAGTGTGGCAGG - Intergenic
930166733 2:48210531-48210553 GGAAAGAGGGAGAGTATAGCAGG - Intergenic
930316198 2:49799825-49799847 GGACAAAGATAGAGTGTGGATGG - Intergenic
930476442 2:51888487-51888509 GGACAGGGGAAGTGGGTGGAGGG - Intergenic
930742390 2:54844985-54845007 AGAAAGAGGGAGAGTGTGAGAGG + Intronic
930867224 2:56133801-56133823 GGCAAGAGAGAGAGAGTGGAAGG - Intergenic
931241074 2:60453017-60453039 GGAGAGCGGGAGAGGGAGGAGGG + Intronic
931779161 2:65564800-65564822 GGAGAGTGGGGGACTGTGGAGGG + Intergenic
931812719 2:65870298-65870320 GGAAAGAGGGAGAGAGAGAAAGG - Intergenic
932005059 2:67919322-67919344 GGGCAGGGGGACGGTGTGGATGG + Intergenic
932026174 2:68135548-68135570 AGACAGAGGGAGAGAGAGAAAGG + Intronic
932131355 2:69190171-69190193 AGACTGAGGGAGAGTGTGCAGGG + Intronic
932278148 2:70466994-70467016 GGACACAGGGAGAGTGTGGGGGG + Intronic
932839876 2:75072183-75072205 GCACAGAGGGAGAGAAGGGAAGG + Intronic
933747962 2:85584529-85584551 GGGCAGAGGGCGAGTGGCGAGGG + Intronic
934508198 2:94913326-94913348 CTACAGAGGGTGAGTGTGAATGG - Intergenic
934513648 2:94969615-94969637 GGACAGACAGAGGGTGTGGCAGG + Intergenic
934567436 2:95348327-95348349 GGATTGGGGCAGAGTGTGGAGGG + Intronic
935895032 2:107726598-107726620 GGAGAGAAGGAGAGTGAAGAAGG + Intergenic
936428288 2:112437086-112437108 GGCCACAGGGAGGGTGGGGAGGG + Intergenic
937760306 2:125592829-125592851 GGACATATGGAGAGTGATGAGGG + Intergenic
937980990 2:127615237-127615259 AGACAGAGGGAAAGGGTAGACGG + Intronic
938043444 2:128095493-128095515 GGACAGGAGGAGAGTGGGGGAGG - Intronic
938214502 2:129499617-129499639 GCACAGGGAGAGGGTGTGGAGGG + Intergenic
938293455 2:130162451-130162473 GCACAGAGGAAGGCTGTGGAGGG - Intronic
938463098 2:131510510-131510532 GCACAGAGGAAGGCTGTGGAGGG + Intergenic
938878009 2:135554168-135554190 GGGAAGAGGGAGAATGTGGAAGG - Intronic
939234827 2:139477629-139477651 GGACAAAGGGAGAATATGGGAGG + Intergenic
939599998 2:144177003-144177025 GGACAAAGAGAGAGAGTGGTGGG + Intronic
939659308 2:144868587-144868609 GAAGAGAGGGAGTGAGTGGAGGG - Intergenic
939660134 2:144878998-144879020 GGACACATGGGGACTGTGGATGG + Intergenic
940753017 2:157648595-157648617 GGAGAGTGGAAGAGTGAGGAGGG - Intergenic
940776626 2:157891597-157891619 GAAGAGAGAGAGAGTGGGGAAGG + Intronic
941623350 2:167803793-167803815 TGACAGAACGAGAGTGTGAATGG - Intergenic
941747115 2:169098555-169098577 GGTCAGAGGGAGGGTTTGGGAGG - Intergenic
942046285 2:172101180-172101202 TGACAGCGGGAGGGTGAGGAGGG + Intronic
942450636 2:176106321-176106343 GGACAGAGAGAGAGAGGAGAAGG + Intronic
942573690 2:177339820-177339842 GGGAAGAGTGAGAGTGAGGAAGG - Intronic
942606881 2:177701220-177701242 GGACAGAGGGTGAGTGAGCAGGG + Intronic
942818388 2:180080467-180080489 GGGGAGAGGGAGAGAGAGGAAGG - Intergenic
943155687 2:184172238-184172260 GGACAGAGGGCGAGAGAGAAAGG + Intergenic
943197526 2:184773642-184773664 GGACTGAGGGAAAGAGTGGGAGG + Intronic
943372881 2:187037576-187037598 GGACACATGGAGAGCCTGGATGG - Intergenic
944492637 2:200273477-200273499 TGACAAAAGAAGAGTGTGGATGG + Intergenic
944612495 2:201425762-201425784 AGAGAGAGAGAGAGTGAGGAGGG + Intronic
944667732 2:201971152-201971174 AGACAGAGGGAGAAAGGGGATGG + Intergenic
944797772 2:203206387-203206409 GGACAGAGGGAGAGAGGGAGAGG - Intronic
944869070 2:203891901-203891923 GGTCAGAGGGAGAGAGAGGTAGG - Intergenic
944922367 2:204428858-204428880 GGACAGGGCAAGAGGGTGGATGG + Intergenic
945339189 2:208631408-208631430 AGAAAGAGGGGGTGTGTGGAAGG - Intronic
945471261 2:210230036-210230058 AGACAGAGAGAGAGTGAGGAAGG + Intergenic
945834426 2:214822085-214822107 GGTCAGAGAGAGAGGGTGGTTGG + Intergenic
946316950 2:218922631-218922653 GGAAAGAGCGAGAGTGAAGAGGG + Intergenic
946678565 2:222189051-222189073 GGACAGAGGGTGAGAGTGAAGGG - Intergenic
946972595 2:225111705-225111727 GAACAGGGGGAAAGTGGGGATGG - Intergenic
946996677 2:225400361-225400383 GGAGGGAGGGAGGGAGTGGAGGG + Intergenic
947091862 2:226521018-226521040 GGACAAAGGGAGGGTTTGGAGGG + Intergenic
947311532 2:228808945-228808967 GGACAGAGGGCCTGTGGGGAGGG - Intergenic
947544273 2:231000337-231000359 GGACAGAAGGAGAGAGGTGAGGG - Intronic
947624031 2:231608294-231608316 GGGCAGAGGGAGAACTTGGAAGG - Intergenic
948029976 2:234809500-234809522 GGACAGACTGACAGTGGGGAGGG - Intergenic
948434986 2:237946995-237947017 AGAGAGAGAGAGAGAGTGGAAGG - Intergenic
948451035 2:238071821-238071843 AGACAGAGGGAGTGCGAGGAAGG - Intronic
948553605 2:238792268-238792290 TGAGAGAGGGAGAGGGAGGAAGG - Intergenic
948741040 2:240046143-240046165 GGGCAGAGGGAGAGTGGAGCTGG + Intergenic
1168743164 20:212324-212346 GGACAGTGGGAAAGTTTGGGAGG - Intergenic
1169006778 20:2213896-2213918 GGAGAGACGGTGGGTGTGGAGGG - Intergenic
1169117776 20:3077001-3077023 GGAAAGAGAAAGAGTATGGAAGG + Intergenic
1169194280 20:3674901-3674923 GGCAAGAGGGAGGGTGTGGTAGG + Intronic
1169369813 20:5020110-5020132 GGAGGGAAGGGGAGTGTGGAGGG - Intergenic
1169759862 20:9079479-9079501 GGACAGGCAGAGAGTGAGGAAGG - Intronic
1169863585 20:10176198-10176220 GGACAGAGTATCAGTGTGGAAGG - Intergenic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1170161130 20:13312605-13312627 GGAGAGCAGGAGAGAGTGGAAGG - Intergenic
1170609008 20:17896164-17896186 GGACAGAAGCAAAGGGTGGAAGG - Intergenic
1170637204 20:18117597-18117619 AGACAGAGAGAGAGAGAGGAAGG + Intergenic
1170770461 20:19328185-19328207 GCACAGAGGGTCAGTGTGGCTGG + Intronic
1170969258 20:21102720-21102742 GGAGAGAGGAAGGGAGTGGATGG + Intergenic
1171151885 20:22834781-22834803 GGAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171811961 20:29752348-29752370 AGACAGAGAGAGAGAGTAGAAGG + Intergenic
1172114024 20:32563167-32563189 GGAGGGAGGGAGAGTGGGGAGGG + Intronic
1172114039 20:32563208-32563230 GGAGGGAGGGAGAGTGAGGAGGG + Intronic
1172518884 20:35554646-35554668 GGAGGCAGGGAAAGTGTGGATGG + Intronic
1172578837 20:36030853-36030875 GGTCAGAGGCTGTGTGTGGACGG + Intergenic
1172776654 20:37411439-37411461 GGACAAAGGGAGGGTGAGGAAGG - Intergenic
1172822776 20:37752805-37752827 GTACAGAGGGAGTGCGTGGGTGG + Intronic
1172884588 20:38222627-38222649 TTGCAGAGGGAGAGTGGGGATGG - Intronic
1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG + Intronic
1172917351 20:38452955-38452977 GGCCACAGGCAGAGTGAGGAGGG - Intergenic
1173180533 20:40803413-40803435 GGGCAGGGGGAGGGTGCGGAGGG - Intergenic
1173284281 20:41656141-41656163 AGAGAGAGGGGGAGTGTTGAGGG - Intergenic
1173305189 20:41841212-41841234 GGACGGAGGGAGAGAGGGAAGGG - Intergenic
1173486992 20:43448365-43448387 GGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1173731964 20:45335437-45335459 GGACAGGGTGGGAGTGGGGAAGG - Intronic
1174094042 20:48073834-48073856 GGACAGAAGGAGGATGGGGAAGG - Intergenic
1174169185 20:48605600-48605622 GGACAGAGGGACAGAGGGGATGG + Intergenic
1174216691 20:48921588-48921610 AGACAGAAGGCGAGGGTGGAGGG - Intergenic
1174812618 20:53660099-53660121 GGACGGCGGGAGAGTGTGGCAGG + Intergenic
1175014324 20:55772519-55772541 GCACAGTGGAAGAGTCTGGATGG + Intergenic
1175339685 20:58220508-58220530 AGAGAGAGAGAGAGAGTGGAAGG + Intronic
1175413329 20:58785619-58785641 GGAAAGAGAGAGAGAGAGGAGGG + Intergenic
1175515875 20:59569440-59569462 GGAGAGAGAGAGAGAATGGATGG + Intergenic
1175691970 20:61072055-61072077 GGCAAGAGAGAGCGTGTGGAGGG - Intergenic
1175702047 20:61146631-61146653 AGAGAGAGAGAGAGTGTTGAGGG + Intergenic
1175871874 20:62212985-62213007 GGGGGGAGGGAGAGTGGGGATGG + Intergenic
1175891560 20:62318162-62318184 GGGCAGATGGGGAGTGGGGAGGG + Intronic
1175950219 20:62579652-62579674 GGACAGAGGGAGAGGGAGACAGG - Intergenic
1176071565 20:63229413-63229435 GGGGAGACGGGGAGTGTGGACGG - Intergenic
1176292210 21:5052382-5052404 GGAGGGAGGGAGGGGGTGGATGG - Intergenic
1176293550 21:5058908-5058930 GGACCGAGGGGGAGAGGGGAGGG - Intergenic
1176373964 21:6078125-6078147 GGCCACAGGGAGGGTGGGGAGGG - Intergenic
1176421301 21:6518282-6518304 AGAAAGAGGGAGAGAGTGGCAGG - Intergenic
1176905618 21:14497030-14497052 GCCCAGATGGAGAGTGAGGAGGG - Intronic
1179063043 21:37997455-37997477 GGAGAGAGAGAGAGAGTGGTGGG + Intronic
1179073976 21:38100653-38100675 GGACTGGGGGTGGGTGTGGATGG - Intronic
1179150959 21:38807746-38807768 GGACAGAGAATGAATGTGGAAGG - Intronic
1179193379 21:39142460-39142482 GGACAGAGAGAGAGAGAGAATGG - Intergenic
1179424532 21:41264589-41264611 GGAGAGAGAGAGAGAGGGGAAGG + Intronic
1179558536 21:42196067-42196089 AGAAAGGGGGAGAGTGGGGAGGG + Intergenic
1179696791 21:43126597-43126619 AGAAAGAGGGAGAGAGTGGCAGG - Intergenic
1179749513 21:43460118-43460140 GGCCACAGGGAGGGTGGGGAGGG + Intergenic
1179820563 21:43934616-43934638 GGACAGCGGGAACCTGTGGAGGG + Intronic
1179863710 21:44204740-44204762 GGACCGAGGGGGAGAGGGGAGGG + Intergenic
1179865049 21:44211272-44211294 GGAGGGAGGGAGGGGGTGGATGG + Intergenic
1179875116 21:44263131-44263153 GGGCAGAGGGGCAGTGTGGGAGG + Intergenic
1179876886 21:44273145-44273167 GGGCAGAGGGAAGATGTGGAGGG + Intergenic
1179952669 21:44718886-44718908 GGACAGAGGAAGGGTGTTCAGGG - Intergenic
1181595705 22:23913299-23913321 GGACAGAGGGACAGTGGCAAGGG - Intergenic
1181885277 22:26017132-26017154 GGAGGGAGGGAGGGAGTGGAAGG - Intronic
1181930067 22:26393958-26393980 GGGCAGATGGAGGATGTGGAGGG + Intergenic
1182022427 22:27091891-27091913 GGACAGAGGGACGGTGTGAGGGG + Intergenic
1182033018 22:27174919-27174941 GGATGGAGAGTGAGTGTGGAGGG + Intergenic
1182110454 22:27719414-27719436 GGACAGTGGGAGAGAAAGGAGGG - Intergenic
1182303567 22:29352543-29352565 GGACACAGGTGGAGTCTGGAGGG - Intronic
1182330963 22:29551792-29551814 GGAGAGAGGGGGAGGGGGGAGGG - Intronic
1182714017 22:32340748-32340770 GGACAGAGGGACAGTGGGGTGGG + Intergenic
1182768162 22:32773847-32773869 GGAAGGAGGGAGAGTGAGGAAGG + Intronic
1183146302 22:35995641-35995663 GGAGAGAGAGAGAGTGTGAAGGG - Intronic
1183301070 22:37059484-37059506 GGACAGGCGGGGAGGGTGGAGGG - Intronic
1183361144 22:37384144-37384166 GGAGAGAGGCAGGGGGTGGAAGG + Intronic
1183668184 22:39257015-39257037 GGCCAGAGGGAGGGCCTGGAAGG + Intergenic
1183675482 22:39296921-39296943 GGACTGAGGGAGAGTTGGGGAGG - Intergenic
1184229634 22:43151680-43151702 GGACAGAGGGAAACTGAGGCCGG + Intronic
1184275258 22:43406223-43406245 GGACAGAGGGATAGCGAGGAGGG - Intergenic
1184445232 22:44543187-44543209 GGGCAGAGGGAGAGTCTGAGAGG - Intergenic
1184521052 22:44994376-44994398 AGACAGAGGCAGAGACTGGAGGG + Intronic
1184652804 22:45926825-45926847 GCCGAGAAGGAGAGTGTGGAGGG + Intronic
1184822272 22:46918261-46918283 GGAGAGAGGGAGATGGTGCAGGG + Intronic
1184863838 22:47191849-47191871 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1184886033 22:47345001-47345023 AGACAGAGGCAGATTCTGGAGGG + Intergenic
1184943029 22:47782664-47782686 GGACAGGGGAAGAGTGTGTGGGG + Intergenic
1185162345 22:49237654-49237676 GGAGAGAGGGAGGGAGGGGAGGG - Intergenic
949404667 3:3701632-3701654 GGAAAGAGAGAGAGTCTGAAAGG + Intronic
949909558 3:8890579-8890601 GGAAGGAGGGAGAGTGGGGGTGG + Intronic
950167829 3:10815041-10815063 GGACAGATGGAGAGTAGGGTTGG + Intergenic
950196211 3:11011026-11011048 GGACAGAGGGAGATTGTCCAAGG + Intronic
950419999 3:12892883-12892905 GCACAATGGGAGAGGGTGGAGGG - Intergenic
950460564 3:13119895-13119917 TGAGTGAGGCAGAGTGTGGACGG - Intergenic
950505296 3:13390906-13390928 GGGCACAGGGAAAGTGTGGGTGG - Intronic
950613429 3:14140407-14140429 GGACAGACTTAGAGTGTGGAGGG + Intronic
950753885 3:15155969-15155991 GGAAGGAGGGAGGGTGGGGAAGG + Intergenic
950907356 3:16551520-16551542 GGAAAGAGAGGGAGTGAGGAAGG + Intergenic
950976981 3:17257005-17257027 GAAGAGAAGGAGAGAGTGGAAGG + Intronic
951034984 3:17922938-17922960 GGACAGAGAAAGAGAGTGCATGG - Intronic
951466702 3:23008117-23008139 GGACAGAAGGCGAGACTGGATGG + Intergenic
951567230 3:24023346-24023368 GGACAGACGGTGAGTGTGTGTGG + Intergenic
953006489 3:38984064-38984086 GGAAAGAGGGAGGCTGTAGAAGG - Intergenic
953557442 3:43957883-43957905 TGAAGGAGGGAGAGTGGGGAGGG + Intergenic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953627644 3:44584358-44584380 GGAGAGAGGGAGATAGTGGTGGG - Intronic
953823563 3:46230813-46230835 GATCAGAGGGCCAGTGTGGAGGG - Intronic
953854680 3:46492189-46492211 AGAAAGAAAGAGAGTGTGGAAGG + Intergenic
953930011 3:47001179-47001201 GGTGAGAGGGAAAGTCTGGAGGG + Exonic
954091691 3:48289405-48289427 GGATTGAGGGAGGGGGTGGATGG + Intronic
954364363 3:50138449-50138471 GGAAAGGGGGAAAGGGTGGAAGG - Intergenic
954639025 3:52087086-52087108 GGATAGAGGGAGAGTGGGGCGGG + Intronic
954696653 3:52431010-52431032 GGAAAGAGGGACAGTGGGTAGGG - Intergenic
954707877 3:52490665-52490687 GGACAGAGGGAGGCGGTGGCAGG - Intronic
954876025 3:53803704-53803726 GGCCAGAGGGAGAGTGGAGCTGG + Intronic
956096512 3:65721975-65721997 GGGCAGAGTGAGAATGTGGGAGG - Intronic
956144258 3:66176378-66176400 ACACAGAGGAAGTGTGTGGATGG + Intronic
956654343 3:71534656-71534678 GGACAGAGCCAGAGTGGGGTTGG + Intronic
956846513 3:73188737-73188759 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956850999 3:73228113-73228135 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956873735 3:73442266-73442288 AGACAGAGGGGAAGTGGGGAGGG + Intronic
957188970 3:76981840-76981862 AGAGAGAGCGAGAGAGTGGATGG + Intronic
957218937 3:77357366-77357388 GGACAGAGGGAGAGAGGGAAAGG - Intronic
957356518 3:79094908-79094930 GGAGAGAGGGAGGGAGGGGAAGG - Intronic
957568545 3:81916211-81916233 GGATAGAGGGAGAGAGAGAAAGG + Intergenic
958144911 3:89612234-89612256 GGAGAGAGGGAGGGAGGGGATGG - Intergenic
958530417 3:95323067-95323089 GGAGGGTGGGAGAGTGTGCAAGG - Intergenic
958830734 3:99085598-99085620 GGACAGAGGGAGAGCATTAAAGG - Intergenic
959105116 3:102056989-102057011 GGAGAAAGGGAGAATGGGGAAGG + Intergenic
960641047 3:119823518-119823540 GGAGAGAGAGAGAGCATGGAAGG + Intronic
960883226 3:122367106-122367128 GGAGACAGGGAGAGGGAGGAAGG + Intronic
960955267 3:123027035-123027057 GCACTGAGGGAGAGTGCGGGCGG - Intronic
961389880 3:126546157-126546179 GGTCAGAGGGAGACTGCGGGAGG - Intronic
961448172 3:126990865-126990887 GCACAAAGAGAGAGTGTGGTGGG - Intronic
961477091 3:127153643-127153665 GGACAAGGGCAGGGTGTGGAGGG + Intergenic
961505542 3:127368633-127368655 GGGCAGGGGGAGAGTGAGGTTGG - Intergenic
961791691 3:129380982-129381004 TTTCAGAGGGAGAGTGGGGAGGG + Intergenic
961827727 3:129607417-129607439 GGAGGGAGGCTGAGTGTGGAGGG - Intergenic
962050681 3:131811571-131811593 GGACAGAAGGAAAATGTGGAAGG - Intronic
962268515 3:133960918-133960940 GGAGAGAAAGAGAGTGTGGAAGG + Intronic
962380241 3:134892794-134892816 GGATAGAGGGAGGGAGGGGAGGG - Intronic
962484476 3:135829018-135829040 GGATGGTGGGAGAGTGGGGATGG + Intergenic
962599851 3:136983460-136983482 GGACAGGGGAAGAGTGAGGAGGG + Intronic
962679341 3:137782420-137782442 GGAGAGAAGGAGAGTGTGAGAGG + Intergenic
962701076 3:138000249-138000271 AGACAGAGGGCCAGTGTGGCAGG + Intronic
962784761 3:138757615-138757637 GGAGGGAGGGAGAGAGGGGAGGG + Intronic
962930373 3:140030428-140030450 AGACAGAAGGAGAGTGGGTAGGG + Intronic
963125288 3:141810378-141810400 AGAGAGAGGGAGAGAGAGGAAGG - Intronic
963149293 3:142027900-142027922 GCACAGTGTGAGAGTGTGGGTGG - Intronic
963275428 3:143325096-143325118 GGAAAAAGGAAAAGTGTGGAAGG - Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
964632718 3:158830358-158830380 AGAGAGAGAGAGAGTGTGAAGGG - Intergenic
964680710 3:159335483-159335505 GGACTGGGGGGGAGTGGGGAGGG - Intronic
966139064 3:176734247-176734269 GGGCAGAGGGAGAGGGAGAAGGG - Intergenic
966351664 3:179038032-179038054 GGACAGGGAGAGAGTGGGGTGGG + Intronic
966425849 3:179778856-179778878 GGAGTGAGGGCGGGTGTGGAAGG + Intronic
966656129 3:182360508-182360530 GGACAGAGTGTGTGTGTGTAGGG + Intergenic
966888491 3:184389637-184389659 GGACAGAGGCCGAGGGTGGCAGG - Exonic
967210166 3:187161460-187161482 GCACAGAGGGAGAATTTGAAAGG - Intronic
967350766 3:188511311-188511333 GGAGGGAGGGAGAGAGGGGAGGG - Intronic
967478175 3:189944711-189944733 GGGCAAAGGGGGAGGGTGGAAGG - Intergenic
967479104 3:189954029-189954051 GGACAGAGTGATACTGTGGATGG - Intergenic
967526763 3:190504053-190504075 GGAGAGGGAGAGAGTGGGGAGGG + Intergenic
967963521 3:194943263-194943285 AGAGAGTGGGAGAGTGTGGGAGG - Intergenic
968027416 3:195454111-195454133 GGAGAGAGTGAGACTGTGGCAGG - Intergenic
968145053 3:196291107-196291129 AGACAGAGAGAGAGAGAGGAAGG + Intronic
968228329 3:196989791-196989813 AGACAGAGGCTGAGTGTGGGTGG + Intronic
968288164 3:197520142-197520164 GCAGAGTGGCAGAGTGTGGAGGG + Intronic
968546227 4:1200385-1200407 TGACAGAGGGAGCAAGTGGAGGG + Intronic
968628184 4:1637423-1637445 GGACAGAGGGAGCCTGGGGGAGG + Intronic
969198338 4:5581272-5581294 GGAGATTGGAAGAGTGTGGAGGG + Intronic
969269138 4:6086843-6086865 GGACGGAGGCAGAGGCTGGAGGG + Intronic
969278183 4:6151051-6151073 AGACAGTGGGAGACTGGGGAAGG - Intronic
969467465 4:7366244-7366266 GGACTGAGAGAGAGAGAGGAAGG - Intronic
969485002 4:7467291-7467313 GGACAGCAGCAGAGAGTGGAAGG + Intronic
969847317 4:9929632-9929654 GGGCAGAGGGAGGGTGTGAGGGG + Intronic
969967092 4:11008074-11008096 GGACAGAGGGAGTGAGGGGGAGG + Intergenic
970015485 4:11507848-11507870 AGAAAGAGAGAGAGTGGGGAGGG + Intergenic
970231287 4:13913705-13913727 GGGCAGAGGGAGACTGTCCATGG - Intergenic
970298100 4:14652857-14652879 GGAGAGGGGGAGAGAGAGGAGGG + Intergenic
970585569 4:17511623-17511645 GGACGGAGAGAGAGTGTAGAAGG - Intronic
970588757 4:17540374-17540396 GGAGACAAGCAGAGTGTGGAAGG + Intergenic
971307327 4:25494974-25494996 GGAGAGAGAGAGAGAGAGGAAGG + Intergenic
971318709 4:25588235-25588257 GGACAGAGCGAGGGTGAGAATGG - Intergenic
971367410 4:25988437-25988459 GCACCGAGGGTGAATGTGGAAGG + Intergenic
971780849 4:31032641-31032663 CGACAGAGAGAGAGAGAGGAAGG + Intronic
972135379 4:35886368-35886390 TGACTGAGGGAGAGGGGGGAAGG - Intergenic
972192940 4:36616619-36616641 GGGCAGAGGAATAGTTTGGAAGG - Intergenic
972562151 4:40238321-40238343 GCACAGAGCGAGCCTGTGGAGGG + Intronic
972640415 4:40920236-40920258 GGAAAGAGAGAGGGTGTGCAGGG - Intronic
972667422 4:41180534-41180556 GGGCAGAGGGAGGGTGAGGCTGG + Intronic
972698154 4:41468228-41468250 GGAGGGAGGGAGAGAGGGGAGGG - Intronic
973279655 4:48345462-48345484 GGTCAGATGGAGAGTGTGGTGGG + Intronic
973589148 4:52422952-52422974 GGACAGAGGGATGGTGATGAAGG + Intergenic
973784298 4:54320838-54320860 GGAAATAGAGAGAGTGTGAATGG - Intergenic
973802338 4:54491780-54491802 TGACAGAGGGACAGTGTCGCTGG - Intergenic
974139674 4:57868928-57868950 GGACAGAGAGAGACAGTGGGGGG - Intergenic
975342611 4:73258675-73258697 GGAAAGAGGGAGGGCGCGGACGG + Exonic
975603300 4:76125837-76125859 GGAGAGAGGGAGAGAGGGGGAGG + Intronic
975654249 4:76625492-76625514 AGACAGAGGGAGAGGCTGGGTGG - Intronic
976113694 4:81703630-81703652 GGACAGAGGGAGAAGTTGGGTGG - Intronic
976633009 4:87258898-87258920 AGACAGAGGGTGAGGGCGGAGGG - Intergenic
976710514 4:88065982-88066004 AGAGAGAGAGAGAGTGTGGTGGG - Intronic
977836111 4:101647779-101647801 GGACAGAGAGGGAGTGAGGAGGG + Intronic
978210179 4:106125718-106125740 GGACATAGGGGGAGAGTGGTGGG + Intronic
978417252 4:108489525-108489547 AGAAACAGGGAGAGTGAGGAAGG - Intergenic
978577241 4:110199254-110199276 GAACAGAGGCAGAGTGGGGAAGG + Intergenic
978660755 4:111123620-111123642 AGACAGAGGGAGAGAGAGGGAGG + Intergenic
978696455 4:111585569-111585591 GGACAGAGAGAGAGAGAGCAAGG + Intergenic
978795125 4:112701185-112701207 AGCCAGAGGGAGAGAGAGGAGGG + Intergenic
978900816 4:113947545-113947567 GGAGAGAGGGAGAGTGAGGGAGG + Intronic
978900828 4:113947592-113947614 GGAGAGAGGGAGAGAGAGGGAGG + Intronic
978912384 4:114079476-114079498 GGAGAGAGAGAGAGCGTGTAGGG + Intergenic
979071989 4:116219751-116219773 GGACAGAGGGAGAGAAAGCAAGG - Intergenic
979143928 4:117216374-117216396 GGAGAGAGAGAGAGTGAGCAGGG - Intergenic
979312426 4:119219375-119219397 TGACAGAGGCAGAGGCTGGAAGG - Intronic
980078834 4:128322403-128322425 GGGAAGAGGAAGAGTGGGGAGGG - Intergenic
980128895 4:128800247-128800269 GGACTGGAGGAGAGTTTGGAAGG + Intergenic
980330815 4:131408863-131408885 GCACAGAGTGGGAGTGTGGCAGG + Intergenic
980754162 4:137135877-137135899 GGAAAGAGAATGAGTGTGGAGGG - Intergenic
980784314 4:137532599-137532621 GGAGGGAGGGCGAGAGTGGAGGG + Intergenic
980793053 4:137644624-137644646 GAACAGGGTGAGCGTGTGGAAGG + Intergenic
980807141 4:137828313-137828335 GGACAGAGAGGAAGTGGGGAAGG + Intergenic
981493313 4:145364544-145364566 GGACATAGGAAGAGTTTGGTTGG + Intergenic
982312974 4:154004673-154004695 GGAGAGACAGAGAGAGTGGAAGG + Intergenic
982320528 4:154072601-154072623 GGGCAAAGGTGGAGTGTGGAGGG - Intergenic
982617981 4:157666050-157666072 AGACAGAGGGACTGTCTGGACGG - Intergenic
982797393 4:159662883-159662905 GGAGAGAGGGAGAATGAGGTGGG + Intergenic
983166422 4:164482351-164482373 AGTCAGAGGGAGGGTGGGGAGGG + Intergenic
983192376 4:164768288-164768310 GGAAAGAGAGAGAGAGAGGAAGG + Intergenic
983338635 4:166428614-166428636 GGGAAGAGGGAGAGAGGGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984550389 4:181152551-181152573 GGAGAGAGGGAGAGCATGAAAGG + Intergenic
984736540 4:183113975-183113997 AGACCGAGGGAGAATGTGGTTGG + Intronic
984946110 4:184969811-184969833 GGCCCGAGGGACAGTGTGAAAGG - Intergenic
985070810 4:186165064-186165086 GGTCAGAGGGAAAGTGAGGCTGG - Intronic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
985314448 4:188640594-188640616 AGACAGAGGGATAAAGTGGAAGG - Intergenic
985478831 5:94547-94569 GGGCAGGGGGAGAGTGAAGAGGG + Intergenic
985507954 5:295308-295330 TCCCAGAGGGAGAGAGTGGAGGG + Intronic
985544091 5:500584-500606 GGACATGGGGTCAGTGTGGAAGG + Intronic
985544150 5:500773-500795 GGACATGGGGTCAGTGTGGAAGG + Intronic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
985707763 5:1411300-1411322 GGACAGAGGGAGCGTGGCGATGG + Exonic
985740081 5:1610360-1610382 TCCCAGAGGGAGAGAGTGGAGGG - Intergenic
986199818 5:5570486-5570508 GGACAGAGGGAGCATGTGCGGGG + Intergenic
986299739 5:6468402-6468424 CGGCAAAGTGAGAGTGTGGAGGG + Intronic
986570056 5:9155183-9155205 GGAGAGAGGGAGATGGAGGAGGG - Intronic
986851378 5:11817389-11817411 GGAGAGAGAGAGAGAGAGGAGGG + Intronic
986975529 5:13388907-13388929 GGAGAGAGCGAGAGAGTGAAGGG - Intergenic
987028750 5:13955203-13955225 GGAGAGAGAGAGAGTGAGGGGGG - Intergenic
987299629 5:16585819-16585841 GGCAAGAGGGAGTGTGGGGAGGG + Intronic
987546314 5:19314734-19314756 AGAAAGAGGGAGAGAGAGGAAGG + Intergenic
988327452 5:29788205-29788227 AGACAGAGAGAGCTTGTGGAGGG - Intergenic
988780453 5:34516563-34516585 GGACAGAGGGAGAATGGCGGAGG - Intergenic
989576295 5:42991584-42991606 GGACAGAGAGGTGGTGTGGAAGG + Intergenic
989579351 5:43017509-43017531 GGGCAGAGGGATGGTGTGGAAGG + Intergenic
989723584 5:44559572-44559594 GGACTCAGGGAGAGGGTGGAAGG + Intergenic
990032997 5:51284234-51284256 TGAAAGAGGGAGAGACTGGATGG + Intergenic
991202199 5:64007437-64007459 GAAGAGAGAGAGAGTGTGTATGG - Intergenic
991202200 5:64007475-64007497 GGACAGAGAGAGAGTATATATGG - Intergenic
991272190 5:64796957-64796979 GGGCAGAGGGAGAGAGGAGAAGG - Intronic
992081935 5:73241661-73241683 GGAAAGAGTGATAGTGAGGAGGG + Intergenic
992506208 5:77389625-77389647 GGACAGAGATAGACTGTGAAGGG - Intronic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
993109261 5:83635608-83635630 AGACAGAGAGAGAGGGTAGAAGG - Intergenic
993658086 5:90597034-90597056 GGACAGAGGCAGAGGGTAGTTGG + Intronic
993857996 5:93099291-93099313 GGAGAGAGAGAGAGAGTGAAGGG + Intergenic
994019953 5:95011605-95011627 GGAGAGAGAGAGAGTGAGGGAGG - Intronic
994300615 5:98142696-98142718 GGACAGAGTGAGCATGGGGAGGG - Intergenic
994523929 5:100880070-100880092 GGAGAGAGGGAGGGAGAGGAGGG - Intronic
994815121 5:104576227-104576249 GGACAGAGAGAGAGGGAGGAGGG - Intergenic
994824851 5:104699357-104699379 GGAGAGAGAGAGAGAGAGGATGG + Intergenic
995062930 5:107831107-107831129 GGGGAGAGGAGGAGTGTGGAAGG - Intergenic
996279079 5:121705595-121705617 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
996836604 5:127800783-127800805 GGACAGAGGCAGAGAGAGGTAGG - Intergenic
996873364 5:128216074-128216096 GGACAGAGGCATTCTGTGGAGGG + Intergenic
997259157 5:132452501-132452523 GGAGAGAGGAAAAGTGGGGATGG - Intronic
997296034 5:132769011-132769033 GAAAGGAGGGACAGTGTGGAAGG + Intronic
997431671 5:133845124-133845146 TCACAGAGGCAGGGTGTGGATGG + Intergenic
997439332 5:133898290-133898312 GGACACAGGGAAGCTGTGGAGGG + Intergenic
997902468 5:137779566-137779588 GGAAAAAGAGAAAGTGTGGAAGG - Intergenic
998156417 5:139789232-139789254 GGACTGAGAGGGAGTGTGCAGGG + Intergenic
998159592 5:139805944-139805966 TGCCACAGGGAGAGTGAGGAGGG + Intronic
998204214 5:140147633-140147655 GGACAGAGGGAGTGGGTGTGGGG - Intergenic
998471982 5:142390515-142390537 GGAGAGAGGGAGAGGGTGGAGGG + Intergenic
998525525 5:142839877-142839899 CGACAGAGAGAGAGAGAGGAGGG + Intronic
998816391 5:146018242-146018264 GGAGAGAGGGAGGGTGAGGGTGG - Intronic
998955877 5:147437589-147437611 GGCCCCATGGAGAGTGTGGAAGG + Intronic
999300673 5:150488319-150488341 GGGCTGAGAGAGAGTGTGGTGGG + Intronic
999511549 5:152257646-152257668 AGACACAGGGAGAGTGAAGAAGG + Intergenic
999567714 5:152884066-152884088 AGTTAGAGGGAGAGTGTGGTAGG - Intergenic
999576840 5:152988297-152988319 TGACTGAGGCAGAGTGTGCAGGG + Intergenic
999593222 5:153172090-153172112 GGACTCAGGGAAAGAGTGGAAGG - Intergenic
999652443 5:153780780-153780802 GAAGAGATGGTGAGTGTGGAGGG - Intronic
999707087 5:154283493-154283515 TGACAGAGTGAGAGTGAGGTGGG + Intronic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000096231 5:157973325-157973347 GGAAAGAGGGAGGGTGAGAAGGG - Intergenic
1000166798 5:158657551-158657573 GGGCAGAGTGTGAGTGAGGAAGG - Intergenic
1000210119 5:159100608-159100630 GGACAGAGGGAAAGGGAGGCGGG + Intergenic
1000338585 5:160260159-160260181 GGCCAGATGGAGAGTAGGGAGGG - Intronic
1000531048 5:162420280-162420302 GGAGAGAGGGAGATGGGGGAAGG + Intergenic
1000810447 5:165855022-165855044 GGATAGAGTAAGAGTGGGGATGG + Intergenic
1001215425 5:169851764-169851786 GGAGAGAGGGAGAGAGAGAAGGG + Intronic
1001595529 5:172896428-172896450 GGACAGGGGCACCGTGTGGATGG + Intronic
1001827803 5:174760094-174760116 TGGCAGAGGGTGAGTGTTGAGGG + Intergenic
1002018057 5:176341565-176341587 GGACAGAAGGACAGTGGAGAAGG + Intronic
1002225826 5:177722607-177722629 GCACAGAGGTAGAGGGAGGAGGG + Intronic
1002400944 5:178991327-178991349 GGAGGCAGGGAGAGTGTGTAAGG + Intronic
1002414974 5:179115598-179115620 GGAAGGAGGGAGAGGGTGAAAGG + Intronic
1002726076 5:181297489-181297511 GGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1002848499 6:969828-969850 GGACAGAGGAACAGCGTGGCTGG - Intergenic
1003202798 6:3977774-3977796 GGACAGAAGGAGAGAAGGGAAGG - Intergenic
1003238144 6:4316994-4317016 GCAGGGAGGGAGAGTGAGGATGG + Intergenic
1003682010 6:8265949-8265971 GGAAAGGCGGAGAGAGTGGAAGG + Intergenic
1003719971 6:8691455-8691477 GGACAGGGGAAGAGGGTGGCAGG + Intergenic
1003912193 6:10752763-10752785 GGAAAGAGGGAGGGAGTGGGAGG + Intronic
1004322679 6:14644912-14644934 TGAAAAAGGGAGAGGGTGGAGGG + Intergenic
1004924626 6:20404228-20404250 GGACAAAGGGAGGGGGTGGCGGG - Intronic
1005200950 6:23343172-23343194 TGCCACAGGGAGGGTGTGGAGGG - Intergenic
1005223978 6:23620131-23620153 GGACAGAGAGAGAGGGAGGGGGG + Intergenic
1005223985 6:23620152-23620174 GGACAGAGAGAGAGGGAGGGGGG + Intergenic
1005585111 6:27268743-27268765 AGAAAGAGGAAGATTGTGGACGG + Intergenic
1005861550 6:29906389-29906411 GGACACTTGGAGAGTGTGGAGGG + Intergenic
1006110660 6:31742974-31742996 GGATAGAGGGAAAATGGGGAAGG + Intronic
1006180729 6:32151974-32151996 GGGCGGAGGGAGAGCGGGGAGGG + Intronic
1006259946 6:32859363-32859385 GGAGAGAGGGAGAGAGAGGATGG - Intronic
1006414082 6:33893110-33893132 GGACAGCGGGCGTGTGGGGAGGG - Intergenic
1006452744 6:34114570-34114592 GGGCAGAGGGTGAGTGGAGAGGG - Intronic
1006754495 6:36403507-36403529 GGAGAGAGGGCAGGTGTGGAAGG + Intronic
1006897856 6:37482242-37482264 GAACAGAGGAAGGGCGTGGATGG - Intronic
1007036389 6:38678365-38678387 GGAGGGAGGGAGAGAGAGGAAGG + Intronic
1007074985 6:39060625-39060647 GGGCAGAGGGAGAGAGAGGCTGG - Intronic
1007095090 6:39208062-39208084 GCACAGGGGGAGAGGGAGGAGGG - Intronic
1007311651 6:40951217-40951239 AGAAAGAGGGAGTGAGTGGAGGG - Intergenic
1007324954 6:41052918-41052940 CCACTGGGGGAGAGTGTGGAAGG - Intronic
1007353706 6:41294603-41294625 CCACAGAGGGAGGGTGTGGTGGG - Intergenic
1007554806 6:42756923-42756945 GGAGAGAGGGAGGGTGGGGGGGG - Intronic
1007751348 6:44073640-44073662 GGACAGAGGGAGAGTCCGGGTGG + Intergenic
1008065768 6:47046345-47046367 GGGCAGTGGGGGAGTGGGGATGG - Intergenic
1008074731 6:47133802-47133824 GAAAAGAGGTAGAGTGTGGGAGG + Intergenic
1008598184 6:53064141-53064163 GGAGAGAGCGAGAGAGTGAAGGG - Intronic
1008663677 6:53695216-53695238 GGGCACAGGTAGAGTGAGGAGGG + Intergenic
1008892800 6:56514529-56514551 GGAGAGAGGGAGAGAGAGAAAGG - Intronic
1010622102 6:78089485-78089507 GGAGAGAGGGAGAGGGAGGGAGG + Intergenic
1011085617 6:83537414-83537436 GGAGGGAGGGAGAGAGGGGAAGG - Intergenic
1011434386 6:87321850-87321872 AGAAAGAGAGAGAGTGTGAAGGG + Intronic
1011850955 6:91628282-91628304 GGACAGAGGGAGAGAGAGAAAGG - Intergenic
1012431381 6:99167170-99167192 GGAGAGAGGGAGAGGATGGGTGG + Intergenic
1012442140 6:99270584-99270606 GGAAACAGGTAGAGTGGGGAAGG + Intergenic
1012883425 6:104817390-104817412 GGAGAGAGAGAGTGTGTGCAAGG - Intronic
1013279580 6:108623010-108623032 GGACAGTGGGAGAGCAAGGATGG + Intronic
1013311657 6:108900385-108900407 GCAAAGAGGGAGAAAGTGGAGGG - Intronic
1013374050 6:109496979-109497001 GGGCAGGGTCAGAGTGTGGAAGG - Intronic
1013619119 6:111872354-111872376 GGACAGAGGAAGAGGAGGGAAGG + Intronic
1013836347 6:114341146-114341168 GGAGAGGGGGAGAGAGGGGAGGG + Intronic
1014014199 6:116511007-116511029 AGAAAGAGGGAGAGTGGGAAGGG + Intronic
1014188653 6:118466023-118466045 ACACAGAGGGAGAGCGGGGAGGG + Intronic
1014248635 6:119094001-119094023 GGAGAGAGGGAGGGAGGGGAGGG - Intronic
1014648364 6:124004425-124004447 GAAAAGAGGGAGGGTGGGGAAGG + Intronic
1015161253 6:130154273-130154295 GGAAAGAGGGTGGGTGGGGAGGG + Intronic
1015552436 6:134426129-134426151 AGAAAGAGGGAGAGGGAGGAAGG - Intergenic
1015645228 6:135379973-135379995 GGAGGGAGGGAGAGGGTGAAGGG - Intronic
1016186769 6:141207000-141207022 GGACTGAGGTAGAGCATGGAAGG - Intergenic
1017183167 6:151573722-151573744 GGCAAGAGAGAGAGTGTGCAGGG + Intronic
1017630619 6:156392987-156393009 GGAGAGAGAGAGAGTGAGCATGG - Intergenic
1017712187 6:157180907-157180929 GGGCAGAGGGAGAGGGAAGAAGG - Intronic
1018001407 6:159581636-159581658 GAACAGAGGGAGAGTCAGCAAGG + Intergenic
1018085862 6:160300614-160300636 TGGCAGAGTGAGATTGTGGAGGG - Intergenic
1018244337 6:161807647-161807669 GGACAGAGGCAGAGACTGGAGGG - Intronic
1018418526 6:163621980-163622002 GGACAAAGCTAGAGTGTGTAAGG - Intergenic
1018602875 6:165563985-165564007 GATCAGTGGGAGAGGGTGGAGGG - Intronic
1018609960 6:165638385-165638407 AGACAGAGAGAGAGGGTGGAAGG + Intronic
1018735206 6:166682567-166682589 GAACAGAGTGAGAGGGAGGAGGG + Intronic
1019057833 6:169235898-169235920 GGACAGAGGGAGAGTGTGGATGG - Intronic
1019057851 6:169235986-169236008 TGGTGGAGGGAGAGTGTGGATGG - Intronic
1019057856 6:169236006-169236028 TGGGGGAGGGAGAGTGTGGATGG - Intronic
1019058017 6:169236755-169236777 GGACGGGGAGTGAGTGTGGATGG - Intronic
1019058027 6:169236804-169236826 GGACGGGGAGTGAGTGTGGATGG - Intronic
1019103478 6:169650356-169650378 GGACAGATGGAGGGGATGGAGGG - Intronic
1019158174 6:170052728-170052750 GGAGAGAGGGAGAGGGAGGGAGG - Intergenic
1019160524 6:170065370-170065392 GGACGGAGGGATGGGGTGGATGG - Intergenic
1019160544 6:170065421-170065443 GGACGGAGGGATGGGGTGGATGG - Intergenic
1019160607 6:170065574-170065596 GGATAGAGGGATGGGGTGGATGG - Intergenic
1019160686 6:170065813-170065835 GGATGGAGGGATAGGGTGGATGG - Intergenic
1019160851 6:170066269-170066291 GGATGGAGGGATAGGGTGGATGG - Intergenic
1019160925 6:170066492-170066514 GGACAGAGGGATGGGATGGATGG - Intergenic
1019315066 7:380524-380546 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315080 7:380554-380576 GGACAGAGGGAGGCAGGGGAGGG + Intergenic
1019315095 7:380584-380606 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315110 7:380614-380636 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315125 7:380644-380666 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315138 7:380674-380696 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019327159 7:444151-444173 AGCCACTGGGAGAGTGTGGAGGG - Intergenic
1019421224 7:952192-952214 GGTCATGGGGAGAGTTTGGAAGG + Intronic
1019480740 7:1265546-1265568 GGATAGAGGGAGATTGTGTAGGG + Intergenic
1019483571 7:1277271-1277293 GGAAGGAGGGAGAGGGAGGAGGG - Intergenic
1019628359 7:2032898-2032920 GCACACAGGGAGAGTGTGCATGG + Intronic
1019790158 7:3006778-3006800 GGAAAGAGGGAGGGAGTGGGTGG + Intronic
1020011392 7:4807668-4807690 GGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011500 7:4808039-4808061 GGAGAGAAGGAGAGGGAGGAAGG - Intronic
1020080064 7:5282326-5282348 GGAGGGAGGGAGAGGGAGGAGGG + Intronic
1020436089 7:8163985-8164007 GGACTGAAGGAGAGAGTTGAAGG + Intronic
1020590835 7:10134645-10134667 GGAGAGAGAGAGTGTGTGGAGGG + Intergenic
1021248474 7:18294222-18294244 GGAGAGAGGGTGTGTGTGTATGG + Intronic
1022289072 7:28983944-28983966 GGAGAGAGAGGGAGGGTGGAAGG + Intergenic
1022391940 7:29950887-29950909 GGACAGCTGGAGAGTGAGCAAGG - Intronic
1022478560 7:30727948-30727970 TGAAAGAGGGAGAGGGTGGCAGG - Intronic
1022593761 7:31691622-31691644 GGAAAGATGGAGGGTGGGGACGG + Intronic
1022651974 7:32285762-32285784 GGAGAGAGGAAGGGAGTGGAGGG + Intronic
1023328409 7:39085737-39085759 GGAGAGAGGGAGAGTGTGTGTGG + Intronic
1023351426 7:39323769-39323791 TGAGAGAGAGAGAGTGAGGAAGG + Intronic
1023803258 7:43853007-43853029 AGAGAGAGGGAGAGAATGGATGG - Intergenic
1023863344 7:44227799-44227821 GGACAGAGGGAGAATGTGAGGGG + Intronic
1024070968 7:45785049-45785071 GGAGAGAGGGAGGGAGGGGAAGG - Intergenic
1024335272 7:48200667-48200689 GGAAAGAGGGAGAGGGAGAAAGG + Intronic
1024564982 7:50673483-50673505 GGAGACAGAGAGTGTGTGGAGGG - Intronic
1024586966 7:50850215-50850237 GGAGAGGGGGAGAATGTGGAAGG - Intergenic
1024920112 7:54546153-54546175 GGAGAGAAGGAGAGTGGAGAAGG + Intronic
1025034738 7:55587134-55587156 GAACAGAGGTAGAGTGGTGAGGG - Intergenic
1025198856 7:56949890-56949912 GGAGGGAGGGAGAGGGAGGAGGG - Intergenic
1025673090 7:63627043-63627065 GGAGGGAGGGAGAGGGAGGAGGG + Intergenic
1026099776 7:67375128-67375150 AGACAGAGGGAGAGAGTAGAGGG + Intergenic
1026183245 7:68060825-68060847 GGACGGAGGCAGAGAGTGGAGGG + Intergenic
1026207257 7:68268888-68268910 GGAGAGAGGGAGGGAGGGGAGGG - Intergenic
1027130252 7:75585575-75585597 GGAGAGGCTGAGAGTGTGGAGGG - Intronic
1027344599 7:77244779-77244801 GGTCAGTGGGAGGGTGTGGAGGG - Intronic
1027386362 7:77663043-77663065 GGAAAGAAGGAGAGAGAGGAAGG + Intergenic
1027600003 7:80228243-80228265 GGACAGATGCAGAGATTGGAGGG - Intergenic
1027669483 7:81078007-81078029 GGACAGAGGGCAAGTGTGACAGG + Intergenic
1028033808 7:85953144-85953166 GGAGAGAGTGAGACAGTGGAAGG - Intergenic
1028557192 7:92136751-92136773 GGACTCAGGGAAAGGGTGGAAGG + Intronic
1028696397 7:93717793-93717815 AGAGAGAGGGAGAGAGAGGAAGG + Intronic
1029026323 7:97420741-97420763 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1029026328 7:97420762-97420784 GGAGAGAGGGAGAGGGAGAAAGG + Intergenic
1029124296 7:98286205-98286227 GGACACAGGGAGGGCGAGGATGG + Intronic
1029407353 7:100383494-100383516 GGGAAGAGGCAGAGGGTGGAAGG + Intronic
1029520561 7:101058908-101058930 GGAGAGAGAGAGAGTCTGGGAGG - Intergenic
1030189255 7:106794375-106794397 GGAGAGAAGGGGAGGGTGGAAGG + Intergenic
1030288137 7:107847559-107847581 GGAAAGAGGGAGAGGGGAGAGGG - Intergenic
1030903328 7:115151039-115151061 TGAAAGGGAGAGAGTGTGGATGG - Intergenic
1031820560 7:126496195-126496217 GGACAGAGAGAAAGGGAGGAAGG + Intronic
1031826170 7:126568497-126568519 AGACAGAGGGAGAGAGAGGGAGG - Intronic
1032352208 7:131175119-131175141 GGATAGATGGATAGGGTGGATGG + Intronic
1032546787 7:132750689-132750711 GGAGAGAGGGAGAGAAGGGAGGG - Intergenic
1032675820 7:134129109-134129131 GGAAAGAGGGAGGGAGGGGAAGG - Intronic
1033036320 7:137879323-137879345 GGACAAAGTGGAAGTGTGGAGGG + Exonic
1033753581 7:144379134-144379156 AGACAGAGGCAGAGATTGGAGGG - Intronic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1034086969 7:148330180-148330202 GGACAGATGGAATGGGTGGATGG + Intronic
1034087010 7:148330409-148330431 GGACAGATGGATGGAGTGGACGG + Intronic
1034087133 7:148331015-148331037 GGACAGATGGATGGAGTGGATGG + Intronic
1034422045 7:150995580-150995602 GGACGGGGGGAGAGGGAGGAAGG - Intronic
1034422322 7:150996294-150996316 GAACAGGGGGAGAGGGAGGAGGG - Intronic
1034449720 7:151130823-151130845 GGAGGGAGGGAAAGTGTGGCGGG - Intronic
1034470771 7:151253289-151253311 GGACGGAGGGAGTGAGTGGGAGG - Intronic
1034989881 7:155541732-155541754 GGCCAGGAGGACAGTGTGGATGG + Intergenic
1035038015 7:155908069-155908091 AGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1035114211 7:156509177-156509199 GGAAAAAGGGAGAATGTGAACGG - Intergenic
1035442844 7:158917795-158917817 TGACAGGAAGAGAGTGTGGAAGG - Intronic
1036032845 8:4992211-4992233 GGCGGGAGGGAGGGTGTGGAGGG - Intronic
1037182519 8:16024756-16024778 GGCCAGAAGGAGAGAGTGTATGG + Intergenic
1037753268 8:21696181-21696203 GGACAGAGGGAGAGGGAGAGGGG - Intronic
1037753619 8:21697838-21697860 GGAAAGAGAGAGTGTGTGCAGGG - Intronic
1037984132 8:23276212-23276234 GGAAAGTGGGAGAGAGGGGAGGG - Intronic
1038502206 8:28054607-28054629 GCTCAGAGGGAGAGTGTGAGAGG - Intronic
1038620757 8:29140794-29140816 GGAATGAGGAAGAGTGTGTATGG - Intronic
1038721335 8:30038583-30038605 GAACAGAGGGAGAGGGAGGGAGG + Intergenic
1038756114 8:30342417-30342439 GGACACTGGGAGGGTGAGGAGGG - Intergenic
1038876612 8:31558105-31558127 GGAAAGACGGAGAGTCTTGAGGG - Intergenic
1038899502 8:31826423-31826445 GGAAAGAGGGAGCATGTGTAGGG - Intronic
1040098034 8:43467246-43467268 GGAGAAAGAGAGAGTGGGGAGGG + Intergenic
1040098582 8:43475266-43475288 AGAGAGAGAGAGAGTGTGGTAGG - Intergenic
1040640197 8:49324379-49324401 GGAGAGAGTGAGAGTGAAGAGGG - Intergenic
1040794446 8:51273637-51273659 GGACAGAGGAAGGGGGTGCATGG + Intergenic
1040895733 8:52366440-52366462 GGACAGAGGGGCAGTGAGGCTGG - Intronic
1041115342 8:54530393-54530415 GGACAGAAGGAGGATGTGCAGGG - Intergenic
1041230736 8:55748549-55748571 GGAGAGAGGGAGGGAGGGGAGGG + Intronic
1041480738 8:58317181-58317203 GAACAGAGGTTGAGTGAGGAAGG - Intergenic
1041698143 8:60759412-60759434 GGAGAGAGGGAGAGGGAGAAAGG - Intronic
1042242882 8:66682082-66682104 GGAAGGAGGGAGAGAGAGGAGGG - Intronic
1042285744 8:67108629-67108651 GGAGAAGGGGAAAGTGTGGAGGG - Intronic
1042290212 8:67163065-67163087 GGACAGAGGGTGAGAGAGGATGG + Intronic
1042663029 8:71176799-71176821 GGAAAGAGGGAGAGAATGGAGGG - Intergenic
1042847027 8:73178668-73178690 GGACAGGGGTAGAGTGGGGCTGG - Intergenic
1042997863 8:74720846-74720868 GGAGAGAGAGAGAGTGAAGAGGG + Intronic
1043318240 8:78948071-78948093 AGACAGAGAGAGAGAGAGGAAGG - Intergenic
1043390940 8:79790995-79791017 AGAGAGAGAGAGAATGTGGAAGG + Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1044068437 8:87725646-87725668 GGAGAGAGAGAGAGAGTGAAAGG + Intergenic
1044729732 8:95220260-95220282 GGATGGAGGGAGAGCTTGGATGG - Intergenic
1044817796 8:96130875-96130897 GGAAGGATGGAGAGTCTGGATGG - Intergenic
1044999833 8:97869461-97869483 GGACAGGGGGAGAGGGAGGGCGG + Intronic
1045820744 8:106335103-106335125 GGACAGAGAGAGAGAGAGAATGG - Intronic
1046290941 8:112159938-112159960 GGACAGAGGAAGAGAGGGCAGGG - Intergenic
1047167217 8:122452495-122452517 GAACAGAGCGAGAGAGTGGAAGG + Intergenic
1047575521 8:126149910-126149932 GCACAGAGGGAGAATCTGGTGGG - Intergenic
1047751347 8:127883114-127883136 AGACAGAGAGAGAGAGAGGAAGG + Intergenic
1047800193 8:128301251-128301273 GCACAGAGGGAAAGTGTGTGTGG + Intergenic
1048114395 8:131505408-131505430 GGACAAAAGCAGATTGTGGAGGG - Intergenic
1049059431 8:140264611-140264633 GGAGAGAGAGAGAGAGCGGAGGG + Intronic
1049222013 8:141432670-141432692 GGACTGAGGGACAGGGTGCATGG + Intergenic
1049252131 8:141594946-141594968 GGACAAAGGGACACTGAGGAGGG - Intergenic
1049289092 8:141792064-141792086 AGGCAGAGGGGCAGTGTGGATGG - Intergenic
1049408006 8:142460256-142460278 GGGCAGGGGGTGAGTGTGGCAGG + Intronic
1049605949 8:143529255-143529277 GGACAGAGGGACAGAGGGGTAGG + Intronic
1049982859 9:920749-920771 GGATACAGGGAGTGTGTGGAGGG + Intronic
1050282653 9:4067082-4067104 GGGCAGAAGGGGACTGTGGAAGG - Intronic
1050626536 9:7510162-7510184 GGATGGAGGGAGGATGTGGACGG + Intergenic
1050778691 9:9302527-9302549 GAAAAGTGGGAGAGTGGGGAAGG - Intronic
1050985641 9:12078668-12078690 GGACAGAGGAAGGGGGTGGGGGG - Intergenic
1051230354 9:14949410-14949432 GGAAAGAGGAAGAGGGTGGCTGG + Intergenic
1051379616 9:16442555-16442577 GGAAAGAGGGATAGTAGGGAAGG + Intronic
1052002344 9:23300383-23300405 AGAGAGAGGGAGACTGTGAAAGG - Intergenic
1052106355 9:24522037-24522059 GGAAAGAGGGAGGGAGGGGAGGG - Intergenic
1052287918 9:26807594-26807616 GGAAAGAGAGAGAGTGAGTAGGG + Intergenic
1052887182 9:33661127-33661149 TGACAGAGGAAGAGTGAGCAGGG + Intergenic
1053470989 9:38346119-38346141 GGTCAGGTGGAGAGTGTGGTTGG - Intergenic
1053562776 9:39213023-39213045 GAACAGAGGGAGTGTGCTGATGG + Intronic
1053828579 9:42050988-42051010 GAACAGAGGGAGTGTGCTGATGG + Intronic
1054134374 9:61406019-61406041 GAACAGAGGGAGTGTGCTGATGG - Intergenic
1054601982 9:67136466-67136488 GAACAGAGGGAGTGTGCTGATGG - Intergenic
1054724299 9:68634890-68634912 GGACAGATAGAGAACGTGGAGGG + Intergenic
1055071856 9:72174804-72174826 AGACAGAGACAGAGTGGGGATGG + Intronic
1055140703 9:72874119-72874141 GGAGAGAGAGAGAGAGTGAAGGG + Intergenic
1055223715 9:73968959-73968981 GGAGAGAGGGAGAGAGTGAAGGG - Intergenic
1055982098 9:82014205-82014227 TGACATCTGGAGAGTGTGGAGGG + Intergenic
1056189789 9:84173533-84173555 TCACAAAGGGAGAGTGTGAATGG + Intergenic
1056199084 9:84257220-84257242 GTACAGAGAGAAAGTGTGGGAGG + Intergenic
1056382129 9:86064977-86064999 GAACAGAGTGAGGGTGTGGGAGG + Intronic
1056517620 9:87370500-87370522 GGACAGAAGGAGAGCGTGGGTGG + Intergenic
1056708514 9:88971531-88971553 GGACGGAGGCAGACTGTGGTGGG - Intergenic
1056749121 9:89333590-89333612 TGAGAGAGGGAGAGTAGGGAAGG + Intronic
1057195818 9:93115326-93115348 GGAAAGAGGGGTAGTGAGGAAGG + Intergenic
1057547968 9:96032155-96032177 GGGCTCAGGGTGAGTGTGGAAGG - Intergenic
1057614586 9:96577648-96577670 GGATAGAGGGAGAGTTCGGTGGG - Intronic
1057838895 9:98469269-98469291 GGAAAGAGAGAGAGAGTGAAGGG + Intronic
1057908753 9:99002241-99002263 GGACAAAGGAAGAGAGGGGAAGG - Intronic
1057929999 9:99185034-99185056 GGAAGGACGGAGAGTGAGGAGGG + Intergenic
1057937396 9:99252374-99252396 GGAAAGAGGGAGAGAGAGAAGGG + Intergenic
1058314523 9:103548308-103548330 GGAGAGAGGGAGAGAGAGGGAGG + Intergenic
1058561411 9:106233044-106233066 GAACGGAGGGGGAGTGAGGAAGG - Intergenic
1058935714 9:109767633-109767655 GGGCAGAGGGAGCGAGGGGAGGG - Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059140842 9:111851794-111851816 GCCCAGGGGGAGAGAGTGGATGG - Intergenic
1059183373 9:112241793-112241815 GGAGAGAGGGAGATTGCAGAGGG - Intronic
1059453125 9:114383261-114383283 GGAAAGAAGGAGAGGGTTGAGGG - Intronic
1059607306 9:115847794-115847816 GGAAAGAGGGAGACTCTTGAGGG - Intergenic
1059922904 9:119177990-119178012 GGAAAGGTGGAGAGTGGGGAAGG + Intronic
1060060217 9:120453250-120453272 AGACAGAGGGAGTGAGGGGAAGG + Intronic
1060112013 9:120913314-120913336 GAGCAGAGGGTGAGTGTGGGAGG - Exonic
1060262414 9:122088057-122088079 GGACTGAAGGAGAGTGGGCAAGG + Intronic
1060315669 9:122508105-122508127 GGAAGGAGGGAGAGTGAGGGGGG + Intergenic
1060387214 9:123241997-123242019 GGACACAGTGGGTGTGTGGAAGG - Intronic
1060864892 9:126987898-126987920 GGAAAGAGTGAGGGTGAGGATGG + Intronic
1060984976 9:127814751-127814773 CCCCAGAGTGAGAGTGTGGATGG + Intergenic
1061026823 9:128055290-128055312 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1061318768 9:129814712-129814734 GCAGAGAGGCAGAGTGGGGAAGG + Intronic
1061553288 9:131350193-131350215 GGAGGGAGGAAGAGTGTGGCCGG + Intergenic
1061642643 9:131971355-131971377 GGACAGGGGGAGAGAGAGGGAGG + Intronic
1061650389 9:132043405-132043427 GGAGAGAGGGAGAATGAGGAGGG + Intronic
1061916842 9:133759841-133759863 GGACAGAGGGAGGGCAAGGACGG + Intergenic
1062103873 9:134742146-134742168 GAGCAGCGGGAGAGTGTGCAGGG - Intronic
1062147368 9:134997096-134997118 GGTGAGTGGGAGAGTGTGGAGGG + Intergenic
1062275122 9:135726872-135726894 GGAGAGAGGGAGAGAGAGAATGG - Intronic
1062275144 9:135726976-135726998 GGAGAGAGGGAGAGAGAGAATGG - Intronic
1062379459 9:136280317-136280339 GCTCAGAGGGTGTGTGTGGAAGG + Intergenic
1062416746 9:136455029-136455051 GGTGAGATGGAGAGTCTGGAGGG + Intronic
1062586298 9:137251447-137251469 GGGCTGAGGGACAGTGTGGGGGG + Intronic
1185632528 X:1525425-1525447 AGACAGAGGCAGAGATTGGAGGG + Intronic
1185660513 X:1724972-1724994 GGAGAGAGAGAGTGAGTGGATGG - Intergenic
1185708465 X:2282643-2282665 GGAGAGAGGGAGAGAGAGAATGG + Intronic
1185918747 X:4065492-4065514 GGACAGAGGGAGAAGGGTGAGGG + Intergenic
1186517502 X:10176845-10176867 GGACAGAGGGAACAGGTGGAAGG + Intronic
1187204564 X:17169907-17169929 GGACAGAGGGAGAGCTTGGAGGG - Intergenic
1187447709 X:19373254-19373276 GGAGAGAGGGGAAGTGTCGAAGG + Intronic
1187459921 X:19477820-19477842 GGAGAGAGGGAGAGGGAGGGAGG + Intronic
1187723319 X:22174882-22174904 GGACAAAGTGAGATTGAGGAAGG - Intronic
1188634880 X:32417313-32417335 GCCCAGAGGGAGAGTAGGGATGG + Intronic
1188747379 X:33862758-33862780 GGATAGTGGGTGGGTGTGGAGGG - Intergenic
1188750940 X:33905188-33905210 GAAGAGAGAGAGAGTGTGCAGGG - Intergenic
1189065559 X:37804699-37804721 AGACATAGGGTGTGTGTGGAGGG + Intronic
1189129760 X:38485542-38485564 GGGAAGAGGCAGAGTGCGGAGGG + Intronic
1189161926 X:38817890-38817912 GGGCAGAGGGTGAGAGAGGAAGG + Intergenic
1189546996 X:42051610-42051632 GGAGAGAGGGAGGAGGTGGAAGG - Intergenic
1189615455 X:42778653-42778675 TGGTGGAGGGAGAGTGTGGATGG - Intergenic
1189748383 X:44193710-44193732 AGACAGAGGGAGAGTGGTCAAGG + Intronic
1189760229 X:44314588-44314610 AGACAGAGAGAGAGAGTGGAGGG - Intronic
1189879646 X:45477075-45477097 GGAGAGTGGGAGGGTGGGGATGG - Intergenic
1189987221 X:46564627-46564649 AGACAGAGAGAGAGTGTGTGTGG + Intergenic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190183747 X:48217323-48217345 GGACAGAATCAGAGTGTGCAGGG + Intronic
1190193399 X:48296131-48296153 GGACAGAATCAGAGTGTGCAAGG - Intergenic
1190212848 X:48461332-48461354 AGACAGAGGGACAGCATGGATGG - Intronic
1190658687 X:52635207-52635229 GGACAGAGAGAGTGCGGGGAGGG + Intergenic
1190663628 X:52677732-52677754 GGACAGAATCAGAGTGTGCAGGG + Intronic
1190675795 X:52780690-52780712 GGACAGAATCAGAGTGTGCAGGG - Intronic
1190732716 X:53235633-53235655 GGACAGATGGAGAGAGTGGTTGG + Intronic
1190862359 X:54357406-54357428 GAACAGGGGGAAAGTGGGGAAGG - Intronic
1192830364 X:74744958-74744980 GGAGAGAGGGAGAGAGAGGGAGG - Intronic
1193183406 X:78484475-78484497 GGCAAGAGGGAGCGTGTGCAGGG + Intergenic
1194809567 X:98374326-98374348 GGAGAGAGAGAGAGTGGGGAGGG - Intergenic
1194902482 X:99530201-99530223 TGTCAGGGGGAGAGTGGGGAGGG + Intergenic
1195049133 X:101080644-101080666 GGACAGAGGGACAGGGTGGAGGG + Intronic
1195221950 X:102753119-102753141 GGGCACAGGGAGAGAGGGGAGGG - Exonic
1195327978 X:103773545-103773567 AGACAGGGGTAGAGAGTGGAGGG - Intergenic
1196254172 X:113496368-113496390 GGAGAGAGAGAGAGTGAGGAGGG + Intergenic
1196304056 X:114080099-114080121 AGAGAGAGGGAGAGAGTGAAAGG - Intergenic
1196351303 X:114733697-114733719 GGACAGTGGGAGACAGTAGAGGG - Intronic
1196536214 X:116847814-116847836 AGACAGAGAGAGAGAGAGGAGGG - Intergenic
1196619357 X:117804916-117804938 GGAAAGAGGGAGGGAGGGGAAGG + Intergenic
1196734530 X:118973019-118973041 GGACAGAGGGAGAGGGTCACAGG - Intergenic
1197231344 X:124007136-124007158 GGAGAGGGGGAAAGGGTGGAGGG - Intronic
1197587241 X:128363804-128363826 AGAGAGAGCGAGAGTGTGAAGGG + Intergenic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1198158440 X:133985085-133985107 GGAGAGAGGGTGTGTGTGGACGG - Intronic
1198606222 X:138340950-138340972 GGAGAGAGGGAGGGAGGGGAAGG + Intergenic
1198710436 X:139495712-139495734 TGAGAGAGGCAGAGTGTGGTAGG - Intergenic
1199139100 X:144289112-144289134 AGAGAGAGGGAGAGAGTGAAGGG - Intergenic
1199411459 X:147528580-147528602 GGAGAGAGGGGGAGGGGGGAGGG - Intergenic
1199598831 X:149528533-149528555 GGAGAGAGGGAGAGAGAGGAAGG - Intronic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1199948032 X:152682935-152682957 GGAGAGAGGGAGCGTGTGAGAGG - Intergenic
1199961647 X:152785519-152785541 GGAGAGAGGGAGCGTGTGAGAGG + Intergenic
1200016142 X:153165038-153165060 GGAGAGAAGGAGAGTGGGGAGGG + Intergenic
1200018435 X:153182298-153182320 GGAGAGAGGGAGTGTGTGAGAGG - Intronic
1200310942 X:155076553-155076575 GGAGAGAGAGAGAGTGAGGGGGG + Intronic
1200324317 X:155221885-155221907 GGAAAGATGGAGAGTGTTAATGG + Intronic
1200716479 Y:6551958-6551980 GGATATAGAGAGAGTGGGGAGGG - Intergenic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146272 Y:11067047-11067069 GTACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146336 Y:11067237-11067259 GAAGAGAGGGAGAGAGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201295746 Y:12461845-12461867 GGCCAAAGAGAGAGTGGGGATGG + Intergenic
1201516664 Y:14825490-14825512 GGAGAGAGACAGAGTGTGAAGGG - Intronic
1201741091 Y:17325416-17325438 GGAGAGAGGAAGAGAGGGGAGGG + Intergenic
1201907193 Y:19097613-19097635 GGAGACAGAGAGAGTGTGAAGGG + Intergenic