ID: 1019058348

View in Genome Browser
Species Human (GRCh38)
Location 6:169238759-169238781
Sequence AGGGCACCTTACCTCTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019058348_1019058354 -2 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058354 6:169238780-169238802 CTGAGGATGACACAGCTCTGGGG No data
1019058348_1019058351 -4 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058351 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
1019058348_1019058357 15 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058357 6:169238797-169238819 CTGGGGCCACAGGGACATTCTGG 0: 1
1: 0
2: 1
3: 36
4: 307
1019058348_1019058362 27 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058362 6:169238809-169238831 GGACATTCTGGGAATGTTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1019058348_1019058360 25 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058360 6:169238807-169238829 AGGGACATTCTGGGAATGTTTGG 0: 1
1: 0
2: 0
3: 17
4: 212
1019058348_1019058355 5 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058355 6:169238787-169238809 TGACACAGCTCTGGGGCCACAGG No data
1019058348_1019058361 26 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058361 6:169238808-169238830 GGGACATTCTGGGAATGTTTGGG 0: 1
1: 0
2: 2
3: 18
4: 190
1019058348_1019058363 28 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058363 6:169238810-169238832 GACATTCTGGGAATGTTTGGGGG No data
1019058348_1019058356 6 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058356 6:169238788-169238810 GACACAGCTCTGGGGCCACAGGG No data
1019058348_1019058353 -3 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058353 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG No data
1019058348_1019058358 16 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058358 6:169238798-169238820 TGGGGCCACAGGGACATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019058348 Original CRISPR AGGGCACCTTACCTCTGATG TGG (reversed) Intronic