ID: 1019058350

View in Genome Browser
Species Human (GRCh38)
Location 6:169238778-169238800
Sequence CCAGAGCTGTGTCATCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019058350_1019058363 9 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058363 6:169238810-169238832 GACATTCTGGGAATGTTTGGGGG No data
1019058350_1019058365 30 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058365 6:169238831-169238853 GGATGGTGACTAGTTTAGTTTGG 0: 1
1: 0
2: 2
3: 9
4: 90
1019058350_1019058364 13 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058364 6:169238814-169238836 TTCTGGGAATGTTTGGGGGATGG 0: 1
1: 0
2: 1
3: 33
4: 359
1019058350_1019058358 -3 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058358 6:169238798-169238820 TGGGGCCACAGGGACATTCTGGG No data
1019058350_1019058361 7 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058361 6:169238808-169238830 GGGACATTCTGGGAATGTTTGGG 0: 1
1: 0
2: 2
3: 18
4: 190
1019058350_1019058362 8 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058362 6:169238809-169238831 GGACATTCTGGGAATGTTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1019058350_1019058360 6 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058360 6:169238807-169238829 AGGGACATTCTGGGAATGTTTGG 0: 1
1: 0
2: 0
3: 17
4: 212
1019058350_1019058357 -4 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058357 6:169238797-169238819 CTGGGGCCACAGGGACATTCTGG 0: 1
1: 0
2: 1
3: 36
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019058350 Original CRISPR CCAGAGCTGTGTCATCCTCA GGG (reversed) Intronic