ID: 1019058352

View in Genome Browser
Species Human (GRCh38)
Location 6:169238779-169238801
Sequence CCCAGAGCTGTGTCATCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 244}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019058352_1019058357 -5 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG 0: 1
1: 1
2: 3
3: 31
4: 244
Right 1019058357 6:169238797-169238819 CTGGGGCCACAGGGACATTCTGG 0: 1
1: 0
2: 1
3: 36
4: 307
1019058352_1019058361 6 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG 0: 1
1: 1
2: 3
3: 31
4: 244
Right 1019058361 6:169238808-169238830 GGGACATTCTGGGAATGTTTGGG 0: 1
1: 0
2: 2
3: 18
4: 190
1019058352_1019058362 7 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG 0: 1
1: 1
2: 3
3: 31
4: 244
Right 1019058362 6:169238809-169238831 GGACATTCTGGGAATGTTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 206
1019058352_1019058363 8 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG 0: 1
1: 1
2: 3
3: 31
4: 244
Right 1019058363 6:169238810-169238832 GACATTCTGGGAATGTTTGGGGG No data
1019058352_1019058360 5 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG 0: 1
1: 1
2: 3
3: 31
4: 244
Right 1019058360 6:169238807-169238829 AGGGACATTCTGGGAATGTTTGG 0: 1
1: 0
2: 0
3: 17
4: 212
1019058352_1019058358 -4 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG 0: 1
1: 1
2: 3
3: 31
4: 244
Right 1019058358 6:169238798-169238820 TGGGGCCACAGGGACATTCTGGG No data
1019058352_1019058364 12 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG 0: 1
1: 1
2: 3
3: 31
4: 244
Right 1019058364 6:169238814-169238836 TTCTGGGAATGTTTGGGGGATGG 0: 1
1: 0
2: 1
3: 33
4: 359
1019058352_1019058365 29 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG 0: 1
1: 1
2: 3
3: 31
4: 244
Right 1019058365 6:169238831-169238853 GGATGGTGACTAGTTTAGTTTGG 0: 1
1: 0
2: 2
3: 9
4: 90
1019058352_1019058366 30 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG 0: 1
1: 1
2: 3
3: 31
4: 244
Right 1019058366 6:169238832-169238854 GATGGTGACTAGTTTAGTTTGGG 0: 1
1: 0
2: 2
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019058352 Original CRISPR CCCAGAGCTGTGTCATCCTC AGG (reversed) Intronic
900025043 1:264731-264753 ACCAGAGCTTTGTTCTCCTCAGG - Intergenic
900028645 1:354125-354147 ACCAGAGCTTTGTTCTCCTCAGG - Intergenic
900156835 1:1206556-1206578 CCCCGTGCTGTGCCATGCTCGGG + Exonic
900773463 1:4563887-4563909 CCCAGGGCTGTGGCACCCCCTGG - Intergenic
900830920 1:4964837-4964859 CCCAGAGCTGGTGCTTCCTCAGG + Intergenic
901195778 1:7439096-7439118 CCCAGAGCTGCGTCCTCCCAGGG + Intronic
901663406 1:10813070-10813092 GCCAGTGCTGTGCCAGCCTCTGG - Intergenic
903126491 1:21251733-21251755 CCCAGAGCTGGTTCCTCCTGGGG - Intronic
903676757 1:25069183-25069205 CCCAGAGCAGTGTCATCCGAGGG - Intergenic
903847368 1:26286378-26286400 CCCAGATCTGTGTCAGGCACTGG + Intronic
904089539 1:27935145-27935167 CCCAGAGCCGTGGGATTCTCAGG - Exonic
905279716 1:36841372-36841394 CCCATAGCTGGGGCATCCTCTGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906128044 1:43439570-43439592 CCCAGAGCTGAGCCTTCCTATGG + Intronic
906528264 1:46508929-46508951 CCCTGAGCTGAGTCATCCTGGGG - Intronic
906660618 1:47578803-47578825 CCCAGAGCTGTTTCCTTCTCGGG - Intergenic
906746649 1:48226539-48226561 CCCAGAGCTGGTTCTTACTCTGG - Intronic
910014302 1:82502344-82502366 CCTAGAGCTGTATCAGCCTCAGG - Intergenic
912344623 1:108953154-108953176 CCCAGGGCTTTGTCATCTTGGGG - Intronic
912546713 1:110456541-110456563 CCTCAAGCTGTGACATCCTCAGG - Exonic
912551594 1:110488667-110488689 CCCACAGCTGGATCAGCCTCTGG - Intergenic
914992624 1:152511830-152511852 CCCAGAGCTGTGGCAGCAGCTGG - Exonic
915004243 1:152622196-152622218 CCCAGAGCTGTGGCAGCAACTGG - Intergenic
915006630 1:152644417-152644439 CCCAGAGCTGTGGCAGCAGCTGG + Intergenic
915225429 1:154407717-154407739 CCCAGAGGTTTGTTTTCCTCGGG + Intronic
915272508 1:154765033-154765055 CCCAGAGCTGACTCTCCCTCAGG - Intronic
915891146 1:159774962-159774984 CCCCGACCTGTGAGATCCTCAGG - Intergenic
915971482 1:160358251-160358273 CCAGGAGCTGTGTCATACTGAGG + Exonic
919456034 1:197819842-197819864 CCCAAAGCTGAGTCATGCTGTGG - Intergenic
922209382 1:223476020-223476042 CCCAGCACTTTGTCATCCTGGGG + Intergenic
1062939911 10:1413295-1413317 CCCAGTGCTGTGTCAGTGTCGGG - Intronic
1065127088 10:22584059-22584081 CCCCAAACTGTGTCATCATCTGG + Intronic
1066435319 10:35392322-35392344 CCCAGAACAGTGCCTTCCTCTGG - Intronic
1067080130 10:43208143-43208165 CCCAGAACTGTGTGATCTTGGGG - Intronic
1067335256 10:45356585-45356607 CCCAGTGCTGTGACTCCCTCAGG + Intergenic
1067836369 10:49644140-49644162 CCCTGAGCTCCCTCATCCTCTGG - Intronic
1068845741 10:61671443-61671465 CACAGAGCTGTGTCAGCATTAGG + Intronic
1070149829 10:73798899-73798921 CTCAGAGCTGTCTCATTCCCAGG - Intronic
1070546821 10:77458987-77459009 CTCAGAGCTGTGTCATCTGAGGG + Intronic
1070557858 10:77543223-77543245 CTCAGAGCTGTGTGCTCCTTTGG - Intronic
1070988366 10:80708411-80708433 CCTAGAGCTGTGTGATTCTGAGG - Intergenic
1071505793 10:86230782-86230804 GCCAGAGCTGTCTCCCCCTCTGG + Intronic
1074446445 10:113524987-113525009 CCCAGAGATGAGTCATCCTCAGG + Intergenic
1074696718 10:116056486-116056508 CCCAGTGCTGTCTCCTCCGCAGG + Intergenic
1075661072 10:124196898-124196920 CCCAGAGCCCTCTCATCCTGTGG - Intergenic
1076785337 10:132746933-132746955 CCCAGAGCTGCCTCATTCACAGG - Intronic
1078614030 11:12848054-12848076 CCCAGAGATGTTTCCTCCTAGGG - Intronic
1079038039 11:17037476-17037498 CCCAGTGCTATGTCAGCTTCAGG + Intergenic
1081683607 11:45026183-45026205 CCCAGAGGTCTCTCATCCTCTGG + Intergenic
1081760041 11:45570783-45570805 CACAGAGCTGTGCCACCCCCAGG - Intergenic
1085085405 11:73663325-73663347 CCAAGAGCTGTGTGATCCAGGGG + Intergenic
1085233045 11:74989184-74989206 CCCACAGTTGAGTCCTCCTCGGG - Intronic
1085522974 11:77149120-77149142 CCCAGAGCTGTGCCGTGCCCGGG + Intronic
1085893836 11:80613030-80613052 CCCACATCTGTATCATCCTCTGG - Intergenic
1087316227 11:96606215-96606237 CCCTGAGCTGTCTCTCCCTCTGG - Intergenic
1090834548 11:130444700-130444722 CCCAGCACTGTGTCAGGCTCTGG + Intergenic
1095887846 12:47207401-47207423 CCCAGAGCTGTGTGAGGCCCAGG + Intronic
1096195859 12:49648411-49648433 CCCAGAGCTATATCAAACTCTGG + Intronic
1096330193 12:50705073-50705095 CCTAGATCTCTGCCATCCTCTGG - Intronic
1096589089 12:52645334-52645356 TCCAGAGCTGTATCCTCCTCCGG + Exonic
1098022581 12:66171037-66171059 CCCAGAGTAGTGTCATCCTAGGG + Intergenic
1099969381 12:89485145-89485167 CCCAGAGCTTTCTCACCTTCAGG + Intronic
1102012734 12:109628589-109628611 CCCGGAGCTGGCTCTTCCTCGGG + Intergenic
1104079152 12:125415107-125415129 CCCTGGGCTGTGTGATCTTCTGG + Intronic
1104688674 12:130807616-130807638 CTCAGGGCTCTGTCTTCCTCTGG + Intronic
1105821028 13:24080979-24081001 CCGAGGGTTCTGTCATCCTCTGG + Intronic
1108108923 13:47046456-47046478 GCCAGAGCTCTGTCTTCCTTTGG + Intergenic
1109245534 13:59950049-59950071 CACAGAGCTGTGTGATACTAAGG + Intronic
1110968127 13:81726593-81726615 CCCAGAGCTGAATGAACCTCGGG + Intergenic
1113091081 13:106618194-106618216 CCCAGAGCTGTATCACCATGAGG + Intergenic
1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG + Intronic
1114866911 14:26606705-26606727 CCCAGAGCTGTGTGAGCACCAGG + Intergenic
1119712200 14:76830343-76830365 CCCACAGCTGTGTCCTCATTAGG - Intronic
1120737243 14:88066598-88066620 GTCAGAGCTGTGTCTTCTTCTGG - Intergenic
1121898708 14:97672812-97672834 CCCACAGGTGTCCCATCCTCAGG - Intergenic
1122858318 14:104570742-104570764 CCCATAGCTGTGTCATGCCCAGG - Intronic
1123123823 14:105930377-105930399 CCCTGGGCTGTGTCCTCCCCTGG + Intronic
1123123840 14:105930425-105930447 CCCTGGGCTGTGTCCTCCCCTGG + Intronic
1123223825 14:106881232-106881254 ACCAGAGCTTTGTTGTCCTCAGG + Intergenic
1202844821 14_GL000009v2_random:159051-159073 CCCAAATCTTGGTCATCCTCAGG - Intergenic
1202914221 14_GL000194v1_random:149298-149320 CCCAAATCTTGGTCATCCTCAGG - Intergenic
1125506714 15:40271595-40271617 CACAGAGGTGTGTCACCATCTGG - Intronic
1128059851 15:64728428-64728450 CCCAGAGCTGGTTCTTCCTCAGG + Intergenic
1128802323 15:70504719-70504741 CCCAGAGCTGTGTCAATGTGGGG + Intergenic
1128862322 15:71084233-71084255 TTCAGAGCTGTGACCTCCTCTGG + Intergenic
1131918822 15:97301204-97301226 CCCAGAGCAGTCACATCCCCTGG - Intergenic
1131931238 15:97444378-97444400 TCCAGAGCTGTGGCATTGTCAGG + Intergenic
1132271429 15:100529694-100529716 CCCAGAGTTGTTTCATCTTCAGG - Intronic
1132398809 15:101492259-101492281 CACAGAGCTGTGTGGACCTCGGG - Intronic
1133236338 16:4388983-4389005 CTAAGAGCTGTGTGATCCTGGGG + Intronic
1138825557 16:60315050-60315072 CCTAGAGCTCTGTCTGCCTCTGG + Intergenic
1139777379 16:69324865-69324887 TCCAGGGCTGTGTCTTCCTTGGG + Exonic
1139842030 16:69889440-69889462 CCCAGAGCTGTCTGATTCACAGG - Intronic
1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG + Intronic
1140355898 16:74306202-74306224 CCCATAGCTCTGGCATCCTCAGG + Exonic
1140534004 16:75692392-75692414 ACCAAAGCAGTGTCATCATCTGG - Intronic
1141799798 16:86299138-86299160 CCCAGGTCTGTGTGATGCTCTGG - Intergenic
1142126244 16:88412039-88412061 GCCAGAGCCGAGTCAGCCTCAGG + Intergenic
1142456112 16:90224646-90224668 ACCAGAGCTTTGTTCTCCTCAGG + Intergenic
1142575740 17:906228-906250 CCCAGAGCTGTGTGGTCCAGGGG - Intronic
1145212394 17:21023869-21023891 CCCAGAGCTGTGTGATGATTAGG + Intronic
1145911494 17:28546055-28546077 CCCAGAGCTGACGCACCCTCTGG - Intronic
1148482529 17:47969596-47969618 CCCAGCGCTGTGAGATCCTGGGG + Intronic
1149666831 17:58370860-58370882 CCCAGAGCTGGGTGAAGCTCCGG + Intronic
1151467395 17:74296034-74296056 CCCAGAGCTGTGTCATGCTCAGG - Intronic
1151665202 17:75541619-75541641 CCCAGAGCGCTGTCACCTTCTGG - Intronic
1151924564 17:77185286-77185308 TCCAGAGCTCTGTCAGCGTCAGG - Intronic
1152502424 17:80721219-80721241 TCCAGTGCTCTGTCATCCTGGGG + Intronic
1152951112 17:83232432-83232454 ACCAGAGCTTTGTTCTCCTCAGG + Intergenic
1153180645 18:2429169-2429191 CCAAAAGCTGTGTCACTCTCAGG + Intergenic
1153517120 18:5914196-5914218 CCCTGAGCTGACTCATCCACTGG - Intergenic
1153819065 18:8817306-8817328 CAAAGAACTGTGTCATCATCAGG + Intronic
1153976477 18:10272430-10272452 CCCAGAGCTCTGGCATTCTTGGG + Intergenic
1154485380 18:14867984-14868006 CACAGAGCTGTGCCATATTCAGG - Intergenic
1155089678 18:22494297-22494319 CCAAGAGCTGTGGCTTCCTGGGG + Intergenic
1158107738 18:53904728-53904750 CCAAGAGGTGTGCCTTCCTCGGG - Intergenic
1158751803 18:60270788-60270810 CCTATAGCAGTGGCATCCTCTGG + Intergenic
1159998609 18:74993459-74993481 GCCAGAGCTGTGTTTTCCTGGGG + Intronic
1161199535 19:3006682-3006704 CCCAGGGCTGGGTCATGCCCCGG - Intronic
1162068250 19:8138418-8138440 CCCTGAGCTGTGTCCTCCTCGGG - Exonic
1163263804 19:16206493-16206515 CAGAGAGCTGTGGCATCCCCAGG + Intronic
1163540907 19:17909616-17909638 CCCAGGGCTGTGTCAGCTTCAGG + Intergenic
1163827009 19:19529439-19529461 CCCAGGCCTGTTTCCTCCTCTGG - Exonic
1164575203 19:29401782-29401804 CAGAGAGCTGAGTCAGCCTCGGG - Intergenic
1164999454 19:32749117-32749139 TCCTGTGCTGTGTCATCATCTGG + Intronic
1166318578 19:42002741-42002763 TCCAGGGCTGTGTCCTCTTCTGG + Intronic
1166420531 19:42632887-42632909 CTCAGAGCTCTGTCCTCCCCAGG + Intronic
925119499 2:1406531-1406553 CCCAGGGCTGTGTCTTGCTCAGG - Intronic
926086252 2:10022220-10022242 CCCAGGACTGAGGCATCCTCAGG - Intergenic
927289961 2:21395539-21395561 CCCAGAGCTGCCTCTTCCTGGGG - Intergenic
927424225 2:22963222-22963244 ACCAGACTTGTGTGATCCTCTGG + Intergenic
928326546 2:30323829-30323851 CCCAAGGCTGTGACACCCTCAGG - Intergenic
928611677 2:32997693-32997715 TCCAAAGCTGTGACACCCTCAGG + Intronic
929720347 2:44361749-44361771 GCCACAGCTCTCTCATCCTCTGG + Intronic
937076153 2:119108372-119108394 AGAAGAGCTGTGTCATCCTGAGG + Intergenic
937242931 2:120474240-120474262 CCCAGAGCTGCCTGCTCCTCGGG - Intergenic
937335550 2:121060088-121060110 CCCAGAGCTGTCTGACCCTGGGG - Intergenic
938209610 2:129456893-129456915 CCCAGGGCTGGGTCATTCTGTGG - Intergenic
940940026 2:159549497-159549519 TCCAGAGCTGTCTCATCTTTTGG + Intronic
942113791 2:172707582-172707604 CTCACAGCTGTGTCATTCCCTGG + Intergenic
943226695 2:185187477-185187499 CCCAGTGCTATGTTAGCCTCAGG - Intergenic
943300525 2:186191874-186191896 CCCAAAGCTGTGTCTCCCTGAGG - Intergenic
946709633 2:222492599-222492621 CCCAGATCTCTGACATGCTCTGG + Intronic
947350658 2:229241168-229241190 CCCACAGCTGTGTCTTCTTAGGG + Intronic
948272236 2:236683499-236683521 CTCTGAGCAGTGTCATCCTGCGG - Intergenic
948453769 2:238094616-238094638 GCCCGAGCTGTGTCATGCTCAGG - Intronic
948877123 2:240835571-240835593 CCCAAAACTGGGTCATCCTGAGG + Intergenic
949056363 2:241930070-241930092 CCCTGAGCTGTGGCATCGGCAGG - Intergenic
949087608 2:242169447-242169469 ACCAGAGCTTTGTTCTCCTCAGG + Intergenic
1168948382 20:1780049-1780071 ACCAGAGCTGTGTCAGGCCCTGG + Intergenic
1169388073 20:5168092-5168114 TCCAGAGCTGAGTCATTATCTGG + Intronic
1170794217 20:19532384-19532406 CCCAGGACTGTCTCAGCCTCTGG + Intronic
1171379390 20:24722662-24722684 CCCAGAGCTGAGACAACTTCAGG - Intergenic
1174688416 20:52478435-52478457 CCCAGAGCTGTGTGATGTTTGGG + Intergenic
1175886629 20:62295535-62295557 CCGAGTCCTGTGTCATCCTCGGG + Exonic
1176633575 21:9163973-9163995 CCCAAATCTTGGTCATCCTCAGG - Intergenic
1176724017 21:10414892-10414914 CACAGAGCTGTGCCATCTTCAGG - Intergenic
1176795954 21:13371492-13371514 CACAGAGCTGTGCCATCTTCAGG + Intergenic
1177929280 21:27260389-27260411 TGCAGTGCTGTGTCATCCTCAGG - Intergenic
1178173755 21:30073358-30073380 CTCAGAGCTTGTTCATCCTCAGG + Intergenic
1180121465 21:45751534-45751556 CCCAGTGCTGCGTCCTCGTCTGG + Intronic
1180139683 21:45885848-45885870 CCGACAGCTCTGTCATCCTGGGG + Intronic
1180170072 21:46053563-46053585 ACCAGCACTGTGTCATCGTCTGG + Intergenic
1180305261 22:11068066-11068088 CACAGAGCTGTGCCATCTTCAGG - Intergenic
1181406979 22:22692100-22692122 CCAAGGGCTTTGTCTTCCTCTGG + Intergenic
1181414970 22:22752865-22752887 CCAAGGGCTTTGTCTTCCTCTGG + Intronic
1182053356 22:27330301-27330323 TCCAGAGCTGTGTGACCCTGAGG - Intergenic
1183348019 22:37318675-37318697 CCCAGATGTGTGTCACTCTCTGG - Intergenic
1184236610 22:43186613-43186635 CGCAGGGCTGTGTCAGGCTCGGG + Intronic
950008110 3:9704312-9704334 CCCAGAACTTTGTCCTCCTGGGG - Intronic
950040556 3:9916861-9916883 TCCAGGGCTGTGTCCTCCTTAGG + Intergenic
950438162 3:12993019-12993041 CCCAGGAGTGTCTCATCCTCAGG + Intronic
950480905 3:13243186-13243208 CCCACAGCCCTGCCATCCTCAGG + Intergenic
950791444 3:15475376-15475398 CCCAGATCTCTGTCAGGCTCTGG - Intronic
952336864 3:32411086-32411108 CCCAGCTCTGTGTCAGCCGCAGG + Intronic
952342945 3:32460278-32460300 CCCAGAGCTGGCCCATTCTCTGG + Intronic
953018364 3:39098785-39098807 ACCACAGCTGTCTCAACCTCAGG - Exonic
954662900 3:52235430-52235452 CCCAGAGCTCGGCCATCCTGCGG - Intronic
957100445 3:75819969-75819991 CCCAAATCTTGGTCATCCTCAGG - Intergenic
958448569 3:94245134-94245156 CCAAGAGCTGTTTTTTCCTCTGG + Intergenic
961509099 3:127390404-127390426 CACAGAGCAGTGACATCCCCGGG + Intergenic
961516901 3:127443729-127443751 CACAGAGCTGAGTTATCCCCAGG + Intergenic
961816515 3:129553451-129553473 CCCAGTGCTGTGGCACCCCCAGG + Intergenic
962164157 3:133031624-133031646 GCCAGAGCTGTGTTATCATGGGG + Intergenic
962311222 3:134328353-134328375 CCCACAGCTGAGTCATCCTTGGG + Intergenic
962347657 3:134630434-134630456 CCCACAACTGTGTCTGCCTCTGG - Intronic
965520542 3:169665055-169665077 TCCAGAGCTGTGTAATTCTGGGG + Intergenic
965638594 3:170809637-170809659 CTCTGAGCTGTCACATCCTCGGG + Intronic
966919562 3:184602874-184602896 CCCAGAGGTGTGTCCTACCCTGG + Intronic
968374056 4:23111-23133 ACCAGAGCTTTGTTCTCCTCAGG - Intergenic
968481944 4:837141-837163 CACAGAACTGTGTCTTCCCCTGG + Intergenic
968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG + Intergenic
969305663 4:6324997-6325019 CACAGAGCAGTGTCACCCTCAGG - Intronic
969415114 4:7052942-7052964 CCCACAGCTGGGGCTTCCTCTGG - Intronic
969714017 4:8859904-8859926 CCCGGATCTGTGTCCACCTCTGG + Intronic
970324028 4:14904394-14904416 CAAAGAGCTGTGCCATGCTCTGG - Intergenic
970649811 4:18164349-18164371 CCAACACCTGTCTCATCCTCAGG + Intergenic
971231213 4:24801139-24801161 CCCAGAGCTGTGGAATCCAAAGG + Intergenic
981005584 4:139871686-139871708 CCCTGAGCTGTGTCTTCCTCAGG + Intronic
984621721 4:181960917-181960939 CACAGAGCTGTGTGATCAGCCGG - Intergenic
985460674 4:190103152-190103174 ACCAGAGCTTTGTTCTCCTCAGG + Intergenic
985714698 5:1448739-1448761 CTCAGAGCTGTATCATTTTCCGG + Intergenic
985992583 5:3575572-3575594 CCCTGAGCTGAGGCGTCCTCTGG + Intergenic
986518311 5:8586636-8586658 CCCCGGGATGTGCCATCCTCAGG + Intergenic
988942412 5:36159619-36159641 CCCAGAGCTGTCTCAACCAAGGG - Intronic
989477560 5:41891637-41891659 CCCACAGCTGCCTCTTCCTCTGG - Intergenic
991721075 5:69494235-69494257 CCCAGTGCAGTGGCATCATCTGG + Intronic
997597539 5:135117109-135117131 CCCAGAGCTGTGTGATGTGCTGG + Intronic
997830421 5:137144947-137144969 CACAGGGCTTTGTCATCCTCTGG - Intronic
997842570 5:137255760-137255782 CCCAGGGTTGTGTCACTCTCAGG - Intronic
999858418 5:155619863-155619885 CTCAGAGCTGTGTCCTCCCTGGG - Intergenic
1002724156 5:181283423-181283445 CACAGAGCTGTGCCATCTTCAGG - Intergenic
1002745345 5:181466246-181466268 ACCAGAGCTTTGTTCTCCTCAGG + Intergenic
1004397581 6:15259465-15259487 CCCAGAGCTGTGACAGCACCAGG + Intronic
1004879595 6:19994618-19994640 CCTACAGCTGTGTTATCCTGTGG + Intergenic
1006153773 6:32003164-32003186 CCCGGAGTTGTGCAATCCTCAGG + Intergenic
1006160081 6:32035901-32035923 CCCGGAGTTGTGCAATCCTCAGG + Intergenic
1006435733 6:34025301-34025323 CCCAGAGCTCCGTCACCCCCTGG + Intronic
1006600869 6:35224889-35224911 CCCAGAGCAGTGCTATCCTGTGG + Intronic
1006790449 6:36697880-36697902 CCCAGGGCTGTGTGTTCCACTGG + Exonic
1007001544 6:38318714-38318736 CCCAGTGCTGTGTTGGCCTCAGG - Intronic
1007470723 6:42088585-42088607 CCCAGAGCTGGGGCCTGCTCAGG - Intergenic
1008055796 6:46944818-46944840 CCCAGAGTTGAGTGAACCTCTGG + Intronic
1014853729 6:126373673-126373695 CCCAGAGATGTCTTATCCTCCGG + Intergenic
1016699165 6:147034363-147034385 CTGAGAGCTGTGTAATCCTAGGG + Intergenic
1017236920 6:152126277-152126299 CCCAAAGCTGCCTCATCTTCAGG + Intronic
1018096767 6:160394400-160394422 CCCAGAGCTGTTGCATCAGCAGG + Intronic
1018552266 6:165011254-165011276 CCCAGAGCTTTGTCTTTCCCAGG - Intergenic
1018714920 6:166524820-166524842 CCACGAGCTGTGTCATCTTGGGG - Intronic
1019058352 6:169238779-169238801 CCCAGAGCTGTGTCATCCTCAGG - Intronic
1019092992 6:169555364-169555386 CCCAGAGCCCTCTCCTCCTCTGG - Intronic
1019250260 6:170739792-170739814 ACCAGAGCTTTGTTCTCCTCAGG + Intergenic
1022472359 7:30689537-30689559 CCCAAGGCTGTCTCCTCCTCAGG + Intronic
1024046184 7:45587239-45587261 CCCAGAGCTGTGGCATGGCCAGG + Intronic
1028325383 7:89517961-89517983 CTCACAGCTTTGTCATTCTCTGG - Intergenic
1028825671 7:95270671-95270693 CCCAGTGCTATGTAAGCCTCGGG - Intronic
1029198391 7:98822454-98822476 TCCAGGGCTGTGTCATCTGCTGG - Intergenic
1029538388 7:101169027-101169049 CCCAGAGCTGGGGAATCCTGGGG + Intergenic
1031194083 7:118590350-118590372 CCCAGGGCTGTGGAAGCCTCAGG - Intergenic
1033361847 7:140643556-140643578 CCCATTGCTGGGTCATCCTGTGG + Intronic
1033673248 7:143512635-143512657 CCCAGATCTGTGCCAGGCTCTGG + Intergenic
1035002572 7:155625425-155625447 CCCAAAGCTCTGCCATCCCCAGG + Intronic
1035321186 7:158030308-158030330 CGCAGAGCTGCCTCATCCTGCGG - Intronic
1035497119 8:61893-61915 ACCAGAGCTTTGTTCTCCTCAGG - Intergenic
1037834271 8:22207068-22207090 CCCAGAGGTCTGCCATCCCCAGG + Intronic
1038499330 8:28030401-28030423 CCCAGATAAGTGCCATCCTCGGG - Exonic
1038718189 8:30010324-30010346 CCCTGAGCTGTGTCAAGCTGTGG + Intergenic
1039437174 8:37567649-37567671 CCCAGGGCTGGCTCATCCTCAGG - Intergenic
1041622637 8:59990401-59990423 CCCAGTGCTGGATCAGCCTCAGG - Intergenic
1042155998 8:65844297-65844319 TGCAGACCTGAGTCATCCTCAGG + Intergenic
1045649401 8:104328338-104328360 CCCAAAGATGGCTCATCCTCAGG + Intergenic
1047310124 8:123684952-123684974 AGGAGAGCTGTGGCATCCTCGGG + Intronic
1047407280 8:124596062-124596084 TCCACAGCAGTGTCATCCTGAGG - Intronic
1047853953 8:128889700-128889722 TCCAGTGCTGTGCCAACCTCTGG - Intergenic
1048056079 8:130866965-130866987 TCCAAAACTGTGTCATCCTCAGG + Intronic
1049306852 8:141908511-141908533 CCCCAAGCTGTGCCAGCCTCTGG + Intergenic
1049349093 8:142154520-142154542 CCCGGGGCTGTGTCAGCCGCCGG - Intergenic
1049456426 8:142693339-142693361 CCCAGAGGTGTGGGATCCTTTGG - Intergenic
1049678092 8:143902437-143902459 CCCAGAGATTTCTCATCCCCAGG - Intergenic
1049678304 8:143903270-143903292 CCCAGGGGTGTGGCTTCCTCGGG + Intergenic
1052431847 9:28376526-28376548 CCCACAGCTGAGTCCTTCTCTGG + Intronic
1053242403 9:36506786-36506808 CCCAAAGCTGTGTTCTCATCAGG - Intergenic
1053396696 9:37781437-37781459 CCCAAAGCTGTGCCATATTCAGG - Intronic
1053488575 9:38482000-38482022 CCCAGCGCTGTGGGAGCCTCAGG - Intergenic
1053886297 9:42646856-42646878 CACAGAGCTGTGCCATCTTCAGG - Intergenic
1054225317 9:62454305-62454327 CACAGAGCTGTGCCATCTTCAGG - Intergenic
1057273438 9:93663837-93663859 CCCAGAGGTGTGTCAGCCAAAGG - Intronic
1057393171 9:94655976-94655998 CACAGAACTGTGTCCTCCTGCGG - Intergenic
1057668931 9:97071296-97071318 CCCAGCGCTGTGGGAGCCTCAGG - Intergenic
1061266969 9:129511760-129511782 CCTAGAGCTGAGACATCCTGAGG - Intergenic
1061358496 9:130124522-130124544 CACAGAGCTGTGACCTCCACTGG - Intronic
1062005365 9:134236076-134236098 CCAGGAGCTGTGGCATCCCCAGG + Intergenic
1062702327 9:137913853-137913875 ACTAGAGCTGTGTCCTCCTGAGG + Intronic
1203756414 Un_GL000218v1:131598-131620 CCCAAATCTTGGTCATCCTCAGG - Intergenic
1203579814 Un_KI270745v1:32389-32411 ACCAGAGCTTTGTTCTCCTCAGG + Intergenic
1189802598 X:44705777-44705799 CACAAAGCTCTGTCATCCTCAGG + Intergenic
1195373577 X:104203403-104203425 ACCAGAGCTGTTTTCTCCTCAGG + Intergenic
1196043247 X:111228858-111228880 CCCAGAGATCTGTCAGCATCAGG - Intergenic
1199477580 X:148262778-148262800 CCCAGTGCTGTGCCTTCCACAGG - Intergenic
1199555874 X:149108122-149108144 CCCAGTTCAGTGTCATCCTGTGG - Intergenic