ID: 1019058357

View in Genome Browser
Species Human (GRCh38)
Location 6:169238797-169238819
Sequence CTGGGGCCACAGGGACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 307}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019058352_1019058357 -5 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG No data
Right 1019058357 6:169238797-169238819 CTGGGGCCACAGGGACATTCTGG 0: 1
1: 0
2: 1
3: 36
4: 307
1019058344_1019058357 30 Left 1019058344 6:169238744-169238766 CCCTTCATTCTCTGTCCACATCA 0: 1
1: 1
2: 2
3: 41
4: 423
Right 1019058357 6:169238797-169238819 CTGGGGCCACAGGGACATTCTGG 0: 1
1: 0
2: 1
3: 36
4: 307
1019058348_1019058357 15 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058357 6:169238797-169238819 CTGGGGCCACAGGGACATTCTGG 0: 1
1: 0
2: 1
3: 36
4: 307
1019058350_1019058357 -4 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058357 6:169238797-169238819 CTGGGGCCACAGGGACATTCTGG 0: 1
1: 0
2: 1
3: 36
4: 307
1019058345_1019058357 29 Left 1019058345 6:169238745-169238767 CCTTCATTCTCTGTCCACATCAG No data
Right 1019058357 6:169238797-169238819 CTGGGGCCACAGGGACATTCTGG 0: 1
1: 0
2: 1
3: 36
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019058357 Original CRISPR CTGGGGCCACAGGGACATTC TGG Intronic