ID: 1019058360

View in Genome Browser
Species Human (GRCh38)
Location 6:169238807-169238829
Sequence AGGGACATTCTGGGAATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019058352_1019058360 5 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG No data
Right 1019058360 6:169238807-169238829 AGGGACATTCTGGGAATGTTTGG 0: 1
1: 0
2: 0
3: 17
4: 212
1019058350_1019058360 6 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058360 6:169238807-169238829 AGGGACATTCTGGGAATGTTTGG 0: 1
1: 0
2: 0
3: 17
4: 212
1019058348_1019058360 25 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058360 6:169238807-169238829 AGGGACATTCTGGGAATGTTTGG 0: 1
1: 0
2: 0
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019058360 Original CRISPR AGGGACATTCTGGGAATGTT TGG Intronic