ID: 1019058361

View in Genome Browser
Species Human (GRCh38)
Location 6:169238808-169238830
Sequence GGGACATTCTGGGAATGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019058352_1019058361 6 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG No data
Right 1019058361 6:169238808-169238830 GGGACATTCTGGGAATGTTTGGG 0: 1
1: 0
2: 2
3: 18
4: 190
1019058348_1019058361 26 Left 1019058348 6:169238759-169238781 CCACATCAGAGGTAAGGTGCCCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1019058361 6:169238808-169238830 GGGACATTCTGGGAATGTTTGGG 0: 1
1: 0
2: 2
3: 18
4: 190
1019058350_1019058361 7 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058361 6:169238808-169238830 GGGACATTCTGGGAATGTTTGGG 0: 1
1: 0
2: 2
3: 18
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019058361 Original CRISPR GGGACATTCTGGGAATGTTT GGG Intronic