ID: 1019058364

View in Genome Browser
Species Human (GRCh38)
Location 6:169238814-169238836
Sequence TTCTGGGAATGTTTGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019058350_1019058364 13 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058364 6:169238814-169238836 TTCTGGGAATGTTTGGGGGATGG 0: 1
1: 0
2: 1
3: 33
4: 359
1019058352_1019058364 12 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG No data
Right 1019058364 6:169238814-169238836 TTCTGGGAATGTTTGGGGGATGG 0: 1
1: 0
2: 1
3: 33
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019058364 Original CRISPR TTCTGGGAATGTTTGGGGGA TGG Intronic