ID: 1019058365

View in Genome Browser
Species Human (GRCh38)
Location 6:169238831-169238853
Sequence GGATGGTGACTAGTTTAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019058352_1019058365 29 Left 1019058352 6:169238779-169238801 CCTGAGGATGACACAGCTCTGGG No data
Right 1019058365 6:169238831-169238853 GGATGGTGACTAGTTTAGTTTGG 0: 1
1: 0
2: 2
3: 9
4: 90
1019058359_1019058365 5 Left 1019058359 6:169238803-169238825 CCACAGGGACATTCTGGGAATGT 0: 1
1: 1
2: 0
3: 12
4: 187
Right 1019058365 6:169238831-169238853 GGATGGTGACTAGTTTAGTTTGG 0: 1
1: 0
2: 2
3: 9
4: 90
1019058350_1019058365 30 Left 1019058350 6:169238778-169238800 CCCTGAGGATGACACAGCTCTGG No data
Right 1019058365 6:169238831-169238853 GGATGGTGACTAGTTTAGTTTGG 0: 1
1: 0
2: 2
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019058365 Original CRISPR GGATGGTGACTAGTTTAGTT TGG Intronic