ID: 1019062191

View in Genome Browser
Species Human (GRCh38)
Location 6:169264559-169264581
Sequence CAGTGCAATGATGAGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019062189_1019062191 0 Left 1019062189 6:169264536-169264558 CCTGCTTTTGTGGAGGGAGAATC No data
Right 1019062191 6:169264559-169264581 CAGTGCAATGATGAGTTTTGAGG No data
1019062184_1019062191 26 Left 1019062184 6:169264510-169264532 CCGGCTGTGAACGTAGCACACAG No data
Right 1019062191 6:169264559-169264581 CAGTGCAATGATGAGTTTTGAGG No data
1019062188_1019062191 1 Left 1019062188 6:169264535-169264557 CCCTGCTTTTGTGGAGGGAGAAT No data
Right 1019062191 6:169264559-169264581 CAGTGCAATGATGAGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019062191 Original CRISPR CAGTGCAATGATGAGTTTTG AGG Intergenic
No off target data available for this crispr