ID: 1019062529

View in Genome Browser
Species Human (GRCh38)
Location 6:169266452-169266474
Sequence CAAGGCCCTGGCCCCCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019062529_1019062535 4 Left 1019062529 6:169266452-169266474 CCTGGCTGGGGGCCAGGGCCTTG No data
Right 1019062535 6:169266479-169266501 AGCCAGCACAGGTTCTAAAAGGG No data
1019062529_1019062534 3 Left 1019062529 6:169266452-169266474 CCTGGCTGGGGGCCAGGGCCTTG No data
Right 1019062534 6:169266478-169266500 GAGCCAGCACAGGTTCTAAAAGG No data
1019062529_1019062538 20 Left 1019062529 6:169266452-169266474 CCTGGCTGGGGGCCAGGGCCTTG No data
Right 1019062538 6:169266495-169266517 AAAAGGGTCCAGGCTTAGTGAGG No data
1019062529_1019062532 -7 Left 1019062529 6:169266452-169266474 CCTGGCTGGGGGCCAGGGCCTTG No data
Right 1019062532 6:169266468-169266490 GGCCTTGCAGGAGCCAGCACAGG No data
1019062529_1019062537 10 Left 1019062529 6:169266452-169266474 CCTGGCTGGGGGCCAGGGCCTTG No data
Right 1019062537 6:169266485-169266507 CACAGGTTCTAAAAGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019062529 Original CRISPR CAAGGCCCTGGCCCCCAGCC AGG (reversed) Intergenic
No off target data available for this crispr