ID: 1019062531

View in Genome Browser
Species Human (GRCh38)
Location 6:169266464-169266486
Sequence TGCTGGCTCCTGCAAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019062531_1019062535 -8 Left 1019062531 6:169266464-169266486 CCAGGGCCTTGCAGGAGCCAGCA No data
Right 1019062535 6:169266479-169266501 AGCCAGCACAGGTTCTAAAAGGG No data
1019062531_1019062534 -9 Left 1019062531 6:169266464-169266486 CCAGGGCCTTGCAGGAGCCAGCA No data
Right 1019062534 6:169266478-169266500 GAGCCAGCACAGGTTCTAAAAGG No data
1019062531_1019062538 8 Left 1019062531 6:169266464-169266486 CCAGGGCCTTGCAGGAGCCAGCA No data
Right 1019062538 6:169266495-169266517 AAAAGGGTCCAGGCTTAGTGAGG No data
1019062531_1019062537 -2 Left 1019062531 6:169266464-169266486 CCAGGGCCTTGCAGGAGCCAGCA No data
Right 1019062537 6:169266485-169266507 CACAGGTTCTAAAAGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019062531 Original CRISPR TGCTGGCTCCTGCAAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr