ID: 1019062533

View in Genome Browser
Species Human (GRCh38)
Location 6:169266470-169266492
Sequence AACCTGTGCTGGCTCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019062533_1019062538 2 Left 1019062533 6:169266470-169266492 CCTTGCAGGAGCCAGCACAGGTT No data
Right 1019062538 6:169266495-169266517 AAAAGGGTCCAGGCTTAGTGAGG No data
1019062533_1019062537 -8 Left 1019062533 6:169266470-169266492 CCTTGCAGGAGCCAGCACAGGTT No data
Right 1019062537 6:169266485-169266507 CACAGGTTCTAAAAGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019062533 Original CRISPR AACCTGTGCTGGCTCCTGCA AGG (reversed) Intergenic
No off target data available for this crispr