ID: 1019062537

View in Genome Browser
Species Human (GRCh38)
Location 6:169266485-169266507
Sequence CACAGGTTCTAAAAGGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019062533_1019062537 -8 Left 1019062533 6:169266470-169266492 CCTTGCAGGAGCCAGCACAGGTT No data
Right 1019062537 6:169266485-169266507 CACAGGTTCTAAAAGGGTCCAGG No data
1019062531_1019062537 -2 Left 1019062531 6:169266464-169266486 CCAGGGCCTTGCAGGAGCCAGCA No data
Right 1019062537 6:169266485-169266507 CACAGGTTCTAAAAGGGTCCAGG No data
1019062529_1019062537 10 Left 1019062529 6:169266452-169266474 CCTGGCTGGGGGCCAGGGCCTTG No data
Right 1019062537 6:169266485-169266507 CACAGGTTCTAAAAGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019062537 Original CRISPR CACAGGTTCTAAAAGGGTCC AGG Intergenic
No off target data available for this crispr