ID: 1019064202

View in Genome Browser
Species Human (GRCh38)
Location 6:169282208-169282230
Sequence CTTCCCTGCACCGGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019064202_1019064206 -2 Left 1019064202 6:169282208-169282230 CCAGCATCCCCGGTGCAGGGAAG No data
Right 1019064206 6:169282229-169282251 AGCACATCCCTCCATCTTCACGG No data
1019064202_1019064210 18 Left 1019064202 6:169282208-169282230 CCAGCATCCCCGGTGCAGGGAAG No data
Right 1019064210 6:169282249-169282271 CGGACGTGTCCAAAGCCGCGCGG No data
1019064202_1019064212 30 Left 1019064202 6:169282208-169282230 CCAGCATCCCCGGTGCAGGGAAG No data
Right 1019064212 6:169282261-169282283 AAGCCGCGCGGCAATCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019064202 Original CRISPR CTTCCCTGCACCGGGGATGC TGG (reversed) Intergenic
No off target data available for this crispr