ID: 1019068219

View in Genome Browser
Species Human (GRCh38)
Location 6:169320613-169320635
Sequence CAGAGCTATCAGACCTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019068219_1019068222 -8 Left 1019068219 6:169320613-169320635 CCTCCCTAGGTCTGATAGCTCTG No data
Right 1019068222 6:169320628-169320650 TAGCTCTGCAGCCTGCTACCTGG No data
1019068219_1019068223 -5 Left 1019068219 6:169320613-169320635 CCTCCCTAGGTCTGATAGCTCTG No data
Right 1019068223 6:169320631-169320653 CTCTGCAGCCTGCTACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019068219 Original CRISPR CAGAGCTATCAGACCTAGGG AGG (reversed) Intergenic
No off target data available for this crispr