ID: 1019071976

View in Genome Browser
Species Human (GRCh38)
Location 6:169354150-169354172
Sequence GAGGGTGAGCTGAAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3059
Summary {0: 3, 1: 166, 2: 451, 3: 822, 4: 1617}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019071976_1019071987 24 Left 1019071976 6:169354150-169354172 CCACCCTCCTTCAGCTCACCCTC 0: 3
1: 166
2: 451
3: 822
4: 1617
Right 1019071987 6:169354197-169354219 TAGCCCCAGTGAGATAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019071976 Original CRISPR GAGGGTGAGCTGAAGGAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr