ID: 1019077674

View in Genome Browser
Species Human (GRCh38)
Location 6:169402575-169402597
Sequence TTACCATTGTTTAAAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019077672_1019077674 26 Left 1019077672 6:169402526-169402548 CCTATGTAGGATTTTTATATTCA No data
Right 1019077674 6:169402575-169402597 TTACCATTGTTTAAAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019077674 Original CRISPR TTACCATTGTTTAAAACAGG AGG Intergenic
No off target data available for this crispr