ID: 1019078216

View in Genome Browser
Species Human (GRCh38)
Location 6:169408779-169408801
Sequence GCGTCTGCCACAGGCGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019078216_1019078219 0 Left 1019078216 6:169408779-169408801 CCTTCCTCGCCTGTGGCAGACGC No data
Right 1019078219 6:169408802-169408824 AAACCTGCTTCCTGTCTCTATGG No data
1019078216_1019078222 14 Left 1019078216 6:169408779-169408801 CCTTCCTCGCCTGTGGCAGACGC No data
Right 1019078222 6:169408816-169408838 TCTCTATGGATTTGCCTGTATGG No data
1019078216_1019078223 15 Left 1019078216 6:169408779-169408801 CCTTCCTCGCCTGTGGCAGACGC No data
Right 1019078223 6:169408817-169408839 CTCTATGGATTTGCCTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019078216 Original CRISPR GCGTCTGCCACAGGCGAGGA AGG (reversed) Intergenic
No off target data available for this crispr