ID: 1019082107

View in Genome Browser
Species Human (GRCh38)
Location 6:169441435-169441457
Sequence GCGGCAGGTGGGAAGCACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019082101_1019082107 1 Left 1019082101 6:169441411-169441433 CCTAAGTAGATTAGAGTCAGACC No data
Right 1019082107 6:169441435-169441457 GCGGCAGGTGGGAAGCACCGAGG No data
1019082100_1019082107 4 Left 1019082100 6:169441408-169441430 CCACCTAAGTAGATTAGAGTCAG No data
Right 1019082107 6:169441435-169441457 GCGGCAGGTGGGAAGCACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019082107 Original CRISPR GCGGCAGGTGGGAAGCACCG AGG Intergenic
No off target data available for this crispr