ID: 1019082433

View in Genome Browser
Species Human (GRCh38)
Location 6:169444160-169444182
Sequence ATAAAGGATATGGGCAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019082433_1019082440 8 Left 1019082433 6:169444160-169444182 CCCTATTTGCCCATATCCTTTAT No data
Right 1019082440 6:169444191-169444213 CGCAAAAACTTACGCGCTCCTGG No data
1019082433_1019082441 13 Left 1019082433 6:169444160-169444182 CCCTATTTGCCCATATCCTTTAT No data
Right 1019082441 6:169444196-169444218 AAACTTACGCGCTCCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019082433 Original CRISPR ATAAAGGATATGGGCAAATA GGG (reversed) Intergenic
No off target data available for this crispr