ID: 1019083389

View in Genome Browser
Species Human (GRCh38)
Location 6:169452229-169452251
Sequence AGCCGCAGTGAGTAAGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019083389_1019083396 17 Left 1019083389 6:169452229-169452251 CCCACGCCTTACTCACTGCGGCT No data
Right 1019083396 6:169452269-169452291 CTCACTCCTCCCACAGCCTCTGG No data
1019083389_1019083399 24 Left 1019083389 6:169452229-169452251 CCCACGCCTTACTCACTGCGGCT No data
Right 1019083399 6:169452276-169452298 CTCCCACAGCCTCTGGCGCAGGG No data
1019083389_1019083398 23 Left 1019083389 6:169452229-169452251 CCCACGCCTTACTCACTGCGGCT No data
Right 1019083398 6:169452275-169452297 CCTCCCACAGCCTCTGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019083389 Original CRISPR AGCCGCAGTGAGTAAGGCGT GGG (reversed) Intergenic
No off target data available for this crispr