ID: 1019088493

View in Genome Browser
Species Human (GRCh38)
Location 6:169503126-169503148
Sequence CAGAGTGACGAGAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019088488_1019088493 10 Left 1019088488 6:169503093-169503115 CCTCAAGCAAGACACCCTCTGCC 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG 0: 1
1: 1
2: 2
3: 24
4: 335
1019088490_1019088493 -5 Left 1019088490 6:169503108-169503130 CCTCTGCCATGCTGTGAGCAGAG 0: 1
1: 0
2: 1
3: 34
4: 325
Right 1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG 0: 1
1: 1
2: 2
3: 24
4: 335
1019088489_1019088493 -4 Left 1019088489 6:169503107-169503129 CCCTCTGCCATGCTGTGAGCAGA 0: 1
1: 0
2: 4
3: 60
4: 434
Right 1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG 0: 1
1: 1
2: 2
3: 24
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019088493 Original CRISPR CAGAGTGACGAGAAAGAGGC AGG Intronic
900349797 1:2228869-2228891 CAGCGCGCCGAGAAAGCGGCCGG - Exonic
901212994 1:7536935-7536957 CAGAGGGACGAGGAAGATGTGGG - Intronic
901435295 1:9243848-9243870 GAGAGAGATGAGGAAGAGGCGGG + Intronic
901560836 1:10068980-10069002 AAGAGTTAAGAGACAGAGGCAGG - Intronic
901755204 1:11437299-11437321 CAGAGTAAGGTGGAAGAGGCAGG - Intergenic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902359035 1:15932021-15932043 AAGAGTGACCAGAAAGAGATTGG + Exonic
902837808 1:19058165-19058187 GAGGGGGAAGAGAAAGAGGCTGG + Intergenic
902987913 1:20166601-20166623 GAGAGGGACGAGAAAGAAGGTGG - Intronic
903165597 1:21518204-21518226 AAGAGTGACGAGAAAGAGGCTGG + Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
903917039 1:26772202-26772224 CGGAGTGAAGAGAAATAGCCAGG + Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905850991 1:41274818-41274840 CAGGGTGAGGAGAAAGAGAGGGG - Intergenic
907995615 1:59628966-59628988 CAGAGTGATGATTAAGAGTCAGG + Intronic
908290996 1:62667150-62667172 AAGAATGACTAGAGAGAGGCAGG - Intronic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
913512501 1:119574329-119574351 CACAGTGTAAAGAAAGAGGCTGG + Intergenic
915776566 1:158495018-158495040 CTGAGTGTTGGGAAAGAGGCTGG - Intergenic
915901648 1:159850937-159850959 CAAAGAGAGAAGAAAGAGGCTGG + Intronic
916487484 1:165272468-165272490 CAGACTGAGGGGGAAGAGGCAGG - Intronic
916683285 1:167123258-167123280 CAGAGGGACAAGAGAGAGGCTGG - Intronic
917202667 1:172533470-172533492 CAGAGAGCACAGAAAGAGGCAGG - Exonic
918123604 1:181561434-181561456 AAGATTAACTAGAAAGAGGCTGG - Intronic
919645449 1:200090133-200090155 AACAGTGACAAGAAAGAGGTTGG - Intronic
920226798 1:204444964-204444986 GAGAGTGGCGAGAAATAAGCAGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922616144 1:226962272-226962294 CACAGGGATGAGAGAGAGGCTGG - Intronic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
923193808 1:231645001-231645023 CACAGTGAACAGAAAGAGGCTGG - Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1063422391 10:5923743-5923765 GACAGGGACGAGAAAGAAGCAGG + Intronic
1063577555 10:7275337-7275359 CACGGTGAAGAGAAAGGGGCAGG + Intronic
1063819493 10:9818886-9818908 CAGAGTGAAGACACAGAAGCTGG + Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064018037 10:11787864-11787886 AAGACTGCAGAGAAAGAGGCTGG + Intergenic
1064666928 10:17662957-17662979 CAAAGTGAAGAGAGAGAGGAGGG - Intronic
1065184651 10:23159922-23159944 AAGAGTGTCAAGAAAGAGGTTGG - Intergenic
1065495369 10:26321975-26321997 CAGAGTGCCGAGGAAAAGCCAGG + Intergenic
1066046603 10:31600821-31600843 CAGAGTGGGAAGGAAGAGGCTGG - Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1067828272 10:49595275-49595297 CAGTGTGAGAAGCAAGAGGCAGG - Intergenic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1071766540 10:88672341-88672363 CAGAGAGACTGGAAAGAGGAGGG + Intronic
1072263732 10:93707102-93707124 CAGAGGGATTAGTAAGAGGCAGG + Intergenic
1072351055 10:94557608-94557630 AAGAGTCACCAGAAAGAAGCAGG - Intronic
1072873681 10:99148864-99148886 CAGAGGGAAGGGCAAGAGGCAGG + Intronic
1075814468 10:125254245-125254267 CAGAGTGGCTAGAATAAGGCAGG - Intergenic
1076251909 10:128991430-128991452 TAAAGTGAGGAAAAAGAGGCAGG - Intergenic
1078916372 11:15782481-15782503 CAGAGTAATGGGATAGAGGCAGG + Intergenic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080688780 11:34538138-34538160 CAGGGTGACAGGAAAGAGCCTGG - Intergenic
1081529041 11:43945335-43945357 GAGAGAGAAGAGAATGAGGCTGG - Intergenic
1083105024 11:60349006-60349028 CAGAGTGAAGAGAATGGGGTGGG + Intronic
1083400831 11:62422413-62422435 CAGTGTGACGTGAAAGGTGCTGG - Intronic
1083450452 11:62741008-62741030 CACAGAGAAGAGAAATAGGCTGG + Intergenic
1084517390 11:69644238-69644260 CAGAGTAACGGGACACAGGCAGG - Intronic
1087105127 11:94400909-94400931 CAGGTTGACGATGAAGAGGCTGG + Exonic
1087803905 11:102534782-102534804 CATAGTGATGAAAAAGAGGAAGG + Intergenic
1088236799 11:107733493-107733515 GAGAGGGATGAGAAAGAGACAGG - Intergenic
1088720271 11:112586034-112586056 GTGAGTGAAGAGAAACAGGCTGG + Intergenic
1088740041 11:112759844-112759866 CAGAGTGATGAGAAAGAATTGGG + Intergenic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1089113017 11:116072065-116072087 CAGAGAGAACAGATAGAGGCAGG - Intergenic
1089135497 11:116245882-116245904 CACAGAGCCCAGAAAGAGGCAGG - Intergenic
1089764213 11:120751273-120751295 CAGAGGGCAGAGGAAGAGGCAGG + Intronic
1090105733 11:123852158-123852180 CAGAGGGATGACACAGAGGCTGG - Intergenic
1090131832 11:124150779-124150801 CAGGAAGACGAGAAAGAGGAAGG + Intergenic
1090265687 11:125351528-125351550 CAGGCTGACGGGAAAGAGCCCGG - Intronic
1091294090 11:134460357-134460379 GAGAGTGATGAGAATGAGCCGGG - Intergenic
1091386690 12:100523-100545 CAGAGGTCAGAGAAAGAGGCGGG + Intronic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092726193 12:11487920-11487942 CAGAGTGAAAAGGCAGAGGCAGG - Intronic
1092902114 12:13069724-13069746 CAGAGAGATGAGAATGAGGTCGG + Intronic
1096390998 12:51229006-51229028 CTGAGGGACCAGAGAGAGGCAGG - Intergenic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1101359685 12:104014582-104014604 CAGGGAGAGGAGAAAGAGGGTGG + Intronic
1102155880 12:110727364-110727386 AAGAGAGAATAGAAAGAGGCAGG - Intronic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1104325708 12:127795118-127795140 AAGAGTGAAGAGAAAAAAGCAGG - Intergenic
1104419946 12:128627035-128627057 CACAGTGAGGACAAAGATGCCGG - Intronic
1104959942 12:132483877-132483899 CAGACTGAGGAGGCAGAGGCGGG - Intergenic
1105045847 12:133002573-133002595 CAGAGTCATGAGACAGAGGGAGG - Intronic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105779195 13:23691561-23691583 CAGAGTGACATGAAAGATGGGGG + Intergenic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107703319 13:43072376-43072398 CAGAGAGATGAGAAAGATGTTGG + Intronic
1108737685 13:53301876-53301898 CAGAGTCACCATAAACAGGCAGG - Intergenic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1113472660 13:110557905-110557927 CAGGCTGATGAGAAAGCGGCTGG - Intronic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1116762799 14:49035604-49035626 AAAAGTGAAGAGAGAGAGGCAGG + Intergenic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1119592293 14:75900835-75900857 CAGTGTTATGAGAACGAGGCAGG - Intronic
1120571561 14:86124138-86124160 GAGACTGAAGAGACAGAGGCTGG + Intergenic
1120724548 14:87923128-87923150 CAGAGTCATTAGAAACAGGCAGG + Intronic
1120950350 14:90035241-90035263 CAAAGTTACCAGCAAGAGGCAGG - Intronic
1122999595 14:105286173-105286195 CAGGGTGACGAGGAAGTGGCAGG + Intronic
1123505037 15:20933511-20933533 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1123562282 15:21507205-21507227 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1123598527 15:21944492-21944514 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1125434369 15:39629370-39629392 CAAAGTAACCAGAAAGGGGCTGG + Intronic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125672193 15:41481686-41481708 CAGAATCACCAGGAAGAGGCTGG - Exonic
1128349133 15:66877488-66877510 CAGAGACAGGAGAAAGAAGCAGG + Intergenic
1128998690 15:72315924-72315946 CAGCCTGAGGAGGAAGAGGCTGG + Exonic
1130324681 15:82870372-82870394 GAGAGGGAGGAGGAAGAGGCTGG - Intronic
1130893629 15:88153549-88153571 CATAGTGAAAAAAAAGAGGCTGG - Intronic
1131316055 15:91338673-91338695 GAGAGTGAGGAGAGAGAGGGAGG + Intergenic
1131905643 15:97139108-97139130 CAGAGAGAAAAGAAAGAGGTAGG + Intergenic
1202970627 15_KI270727v1_random:234347-234369 AAGAGAGACAAGAAAGTGGCGGG + Intergenic
1133019514 16:2960992-2961014 CAGAGAGATGAGAAAAAGGAAGG + Intergenic
1133065510 16:3203919-3203941 CAGACAGACGGGACAGAGGCTGG - Intergenic
1133769922 16:8861821-8861843 CAGAGTTCCAGGAAAGAGGCTGG + Intronic
1134008808 16:10836021-10836043 CAGAGTAATGGGCAAGAGGCTGG - Intergenic
1134682023 16:16132942-16132964 CAGGTTGACTAGAAAGAGCCAGG - Intronic
1135303617 16:21350839-21350861 CAGAGTGTCCAGGAAGGGGCAGG + Intergenic
1135800928 16:25494572-25494594 CTTAGTGATGAGAATGAGGCAGG + Intergenic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136300363 16:29330034-29330056 CAGAGTGTCCAGGAAGGGGCAGG + Intergenic
1137558462 16:49488319-49488341 CAGAGTGCCCAGAAGCAGGCAGG - Exonic
1138104083 16:54277865-54277887 GAGAGAGACCAGCAAGAGGCAGG + Intergenic
1138652804 16:58471404-58471426 CAGAGTGATCAGAACGAGGCTGG - Intronic
1140380130 16:74479378-74479400 TATAGTGACCAGAAAGATGCCGG + Intronic
1141001525 16:80312768-80312790 CAGGGTGACGGGGAAGAGGGTGG - Intergenic
1143104575 17:4522578-4522600 CTGAGAGAAGAGAAAGAGGGAGG - Intronic
1143857920 17:9866133-9866155 CAGAAAGAAGTGAAAGAGGCAGG + Intronic
1144667108 17:17109460-17109482 CACAGTGACAAGGAACAGGCAGG + Intronic
1145921630 17:28614164-28614186 CAGAGAGAGGAGGCAGAGGCTGG - Exonic
1147035748 17:37679123-37679145 CAGAGAAACGTGAAAGAGGAGGG - Intergenic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148807764 17:50272852-50272874 CAGAGAGAGGAGAAACAGACGGG + Intronic
1149556053 17:57574266-57574288 AATAGTGACGAGAGAGAAGCTGG - Intronic
1150495797 17:65607050-65607072 GAGAGTGATGAGGAAGAGTCTGG + Intronic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151859465 17:76749026-76749048 CAGAGAGAAAAGAAACAGGCAGG + Intronic
1152157995 17:78647549-78647571 CATAGAGAGGAGAGAGAGGCAGG + Intergenic
1152462364 17:80448339-80448361 CAGTGACCCGAGAAAGAGGCTGG + Intergenic
1152517943 17:80837087-80837109 CACCGTGACGGGAAGGAGGCCGG + Intronic
1152688176 17:81704936-81704958 CTGAGAGAGGAAAAAGAGGCTGG + Intronic
1153592310 18:6686579-6686601 CAGAGTGACAGGAAGGAGCCAGG + Intergenic
1155341845 18:24821071-24821093 CAGAGAGGCTAGGAAGAGGCAGG - Intergenic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1157327599 18:46680249-46680271 CGCAGTGACCAGAATGAGGCCGG + Exonic
1158524291 18:58198357-58198379 CAGAGTGACATGTAAGAAGCTGG + Intronic
1158823343 18:61186645-61186667 CAGAGTGATGGGAAAGAGTAGGG - Intergenic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1160531419 18:79567177-79567199 CAGAGGGACGAGGATGAGGCCGG - Intergenic
1161256844 19:3314505-3314527 AAGAGAGAAGAGAGAGAGGCAGG - Intergenic
1161640452 19:5419314-5419336 CAGAGGGACGAGGAATAGGATGG + Intergenic
1161742497 19:6031724-6031746 AAGAGAGGAGAGAAAGAGGCTGG - Intronic
1162911623 19:13850767-13850789 AAGAGTCAAGAGTAAGAGGCAGG - Intergenic
1163575922 19:18110633-18110655 CAGACTGCAAAGAAAGAGGCCGG - Intronic
1163606667 19:18279659-18279681 CAGAGGGAGGAGAGAAAGGCGGG + Intergenic
1164436057 19:28230515-28230537 CTGAGTCACAAGAAAGTGGCTGG + Intergenic
1164743309 19:30593160-30593182 GAGAGCAGCGAGAAAGAGGCCGG - Intronic
1165072344 19:33262687-33262709 CAGGGTGACGAGGAAGAGAGAGG - Intergenic
1166900333 19:46056655-46056677 CAGAGAGACGAGGAGGAGTCAGG + Intronic
1167009393 19:46796728-46796750 GAGAGAGACCAGGAAGAGGCTGG + Intergenic
1167767015 19:51490336-51490358 CTGTGTGGGGAGAAAGAGGCCGG - Intronic
925326927 2:3030084-3030106 CAGAGGGAGAAGAAAGAGGCAGG + Intergenic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
926987330 2:18639198-18639220 CACAAAGATGAGAAAGAGGCCGG - Intergenic
927174744 2:20397911-20397933 CACAGGGCCTAGAAAGAGGCTGG + Intergenic
928698882 2:33878861-33878883 GAAAGAGACGAGAAAGAGACAGG + Intergenic
928720882 2:34119486-34119508 CATAGGGATGAGACAGAGGCAGG + Intergenic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
929052108 2:37846412-37846434 CAGAGAGAGGAGAAAGAGAGAGG - Intergenic
929222893 2:39483733-39483755 CAGAGAGAAGAGGAAGAGGAAGG - Intergenic
934742524 2:96735492-96735514 CAGAGTGACAAGACAGAGACTGG - Intronic
936705699 2:115071225-115071247 GAGAATGACAAGAAATAGGCAGG - Intronic
937434619 2:121870132-121870154 AAGAGTGACGTGACAGAGACTGG - Intergenic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
938065838 2:128281578-128281600 TAGAGCGAAGAGAAAGAGCCTGG + Intronic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938667933 2:133558451-133558473 CAGAGAGATGTGAAAGAGGAAGG + Intronic
938686049 2:133738939-133738961 CAGAGTTACTAAAAAGAGGTTGG - Intergenic
939201230 2:139037686-139037708 GACAGTGAGGATAAAGAGGCAGG - Intergenic
940679666 2:156770158-156770180 GAAAGTGAGGAGAAAGAGACAGG + Intergenic
941145566 2:161839906-161839928 CTGAGTGGCGAGAAACAGCCAGG + Exonic
942261407 2:174168204-174168226 CAAAGGGAAGAGAAAGAGACAGG + Intronic
942522334 2:176817489-176817511 CAGTCTGAGGAGCAAGAGGCTGG + Intergenic
942602708 2:177657870-177657892 CAGGGTGAAGAGAAAGTAGCTGG + Intronic
943577593 2:189649033-189649055 AAGAGGGATGAGAAAGAGGGAGG + Intergenic
944978108 2:205080978-205081000 CACAGTGATGAGAGAGAGGAGGG - Intronic
945050530 2:205819983-205820005 CAGAGAGAAGAGAGAGAGGAGGG - Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948578644 2:238969882-238969904 CAAAGGGAAGAGAAAGAGGGAGG - Intergenic
1168814141 20:725179-725201 CAGACAGAAGAGAGAGAGGCTGG - Intergenic
1170091762 20:12596859-12596881 AAGAGTGAAGAGATAGAGACAGG - Intergenic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1171136748 20:22701535-22701557 CACAGAGACAAGAAAGAGGAAGG - Intergenic
1172009975 20:31841101-31841123 CACAGTGATGAGAAAAAGCCGGG - Intergenic
1172011113 20:31846468-31846490 GAGAGAGAGGAGAGAGAGGCAGG + Intergenic
1172017816 20:31889193-31889215 AAGAGTGAAGAAAAAGAGTCTGG + Intronic
1174310318 20:49648256-49648278 AAGAAAGAAGAGAAAGAGGCTGG + Intronic
1174351102 20:49968835-49968857 GAGAGAGACGAGAAAGAGCAAGG + Intergenic
1176892808 21:14338909-14338931 CAGAGAGACTAGAATGAAGCAGG + Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178308431 21:31509634-31509656 CACAGAGAGGAGAGAGAGGCAGG + Intronic
1178408069 21:32341153-32341175 CAGAGGGATGAGAAAGAAACAGG + Intronic
1179794921 21:43776905-43776927 CAGAGGGATGAGAAGAAGGCAGG + Intergenic
1181795666 22:25307407-25307429 CAGAGTAACGACAAATGGGCAGG - Intergenic
1181836153 22:25610613-25610635 CAGAGTAACGACAAATGGGCAGG - Intronic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182143803 22:27984461-27984483 CAGAGTGACAAGGATGAGGAGGG - Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
949492616 3:4604256-4604278 CACAGTGATGAGTAAGATGCTGG + Intronic
949760036 3:7459983-7460005 AAGAGTGACAAGACAGAGACAGG + Intronic
950124874 3:10504983-10505005 CAGAGTCCCAGGAAAGAGGCAGG - Intronic
950958124 3:17077008-17077030 AAGAGTGGAGAGGAAGAGGCTGG - Intronic
951463026 3:22971219-22971241 CAGAATGACAAGAAATAGCCAGG + Intergenic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
952719635 3:36519006-36519028 CAAAGGGACGTGAAAGAAGCTGG + Intronic
952723945 3:36562154-36562176 CAGAGAGAAGAGAAAGGGCCAGG + Intergenic
953875157 3:46662453-46662475 GTGAGTCAAGAGAAAGAGGCTGG + Intergenic
953938256 3:47066070-47066092 CAGACTGACGAGGAAGAAGAGGG - Intronic
955703119 3:61701900-61701922 GAGAGGGAAGAGAAAGAGGAAGG + Intronic
956254605 3:67270650-67270672 CAGAGTTAAGAAAAAGGGGCTGG - Intergenic
956505127 3:69929743-69929765 CAGAGTGCCAAGACAGAAGCAGG + Intronic
957320659 3:78625960-78625982 CTGAATGAAGAGGAAGAGGCTGG + Intronic
958616059 3:96494445-96494467 CAGAGGGAGGACACAGAGGCAGG - Intergenic
959152648 3:102625807-102625829 CAGAGTGTGGACAAAGGGGCTGG - Intergenic
959931294 3:111986041-111986063 CAGTGTGACTAGCAACAGGCTGG + Intronic
962600858 3:136989989-136990011 CAGGGTGAAGAGGTAGAGGCAGG + Intronic
962982827 3:140506385-140506407 GAGTGTGACGAAAGAGAGGCAGG - Intronic
965874807 3:173303419-173303441 CATAGAGAGGAGAAAGAGGGAGG + Intergenic
965927114 3:173995298-173995320 TACAGAGACGAGAATGAGGCAGG - Intronic
966650172 3:182291798-182291820 CAGTGGGAAGAGAAAGTGGCAGG - Intergenic
966924524 3:184635774-184635796 CAGCGTGGGGAGAGAGAGGCAGG + Intronic
967149736 3:186637584-186637606 CTGAGTGAGGAGGGAGAGGCAGG - Intronic
967404831 3:189103780-189103802 CAGAGACACAAGACAGAGGCTGG - Intronic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
970893787 4:21078188-21078210 AAGAGTGACTGGAAAGAGTCAGG + Intronic
971111062 4:23586582-23586604 CAGAGTGCCCAAAAAAAGGCAGG + Intergenic
972102585 4:35441066-35441088 GAGAGTGGTGAGAAAGAGGAGGG + Intergenic
972633987 4:40866484-40866506 CAAAGTGAGGAGGAAGAGGGAGG - Intronic
973195485 4:47434905-47434927 GAGAGTGAACAGAATGAGGCAGG - Intergenic
974015663 4:56646651-56646673 CAAAATGAAGAGAAAGAGGGAGG - Intergenic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
976858349 4:89630806-89630828 CAGAGTGAAGAAACAGAGGGAGG - Intergenic
977789096 4:101077021-101077043 CAGAGTGAAGACACAGAGGCAGG + Intronic
980211497 4:129794185-129794207 GAGAAGGACGAGAAAGAGGAGGG - Intergenic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981273755 4:142874520-142874542 AAGAGTGAGGAGAAACAGGGTGG + Intergenic
981780612 4:148425461-148425483 CTAAGTGACAAGAAAGAGGCAGG + Intronic
983398879 4:167237484-167237506 CAGAATGACAACAAAGGGGCTGG - Intergenic
983523413 4:168734937-168734959 GAGAGAGAGGAGAAAGAGGAGGG + Intronic
983981111 4:173998677-173998699 GAGACTGACGAGTAACAGGCAGG + Intergenic
984413526 4:179427657-179427679 CACAGAGAAGAGAAAAAGGCTGG + Intergenic
985896368 5:2751820-2751842 CAGAGAGACGGGAGGGAGGCGGG + Intergenic
986564617 5:9099896-9099918 CAGAGTGTCGAGAGTGAAGCTGG - Intronic
987115913 5:14726553-14726575 AAGAGTGACGGGAGGGAGGCTGG + Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987368114 5:17168209-17168231 CAGAGAGATGAGAAGCAGGCAGG + Intronic
987805001 5:22753079-22753101 CAGACTGATGAGAAAGAGCGAGG + Intronic
989393622 5:40929096-40929118 CAGATTGATGAGACAGAGCCAGG + Intronic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
992160156 5:73993026-73993048 CAGAGGGACAAGAAATAGACAGG + Intergenic
995533953 5:113117180-113117202 CAGAGTGAGGAGAGAGGGTCGGG - Intronic
996486959 5:124047088-124047110 TAGAGTGAAGAGAAAGAGAGAGG + Intergenic
997297742 5:132778166-132778188 CAGAGGGAAGAGAAAGAAACGGG - Intronic
997507578 5:134430205-134430227 CAGAGGGAGGGGAAAGAGGTGGG + Intergenic
997992481 5:138556993-138557015 CAGAGTGGCATGAAAGAGTCTGG + Intronic
998172906 5:139882899-139882921 CTGAGGAACAAGAAAGAGGCAGG + Intronic
999099885 5:149014786-149014808 CAGAGTGGGGAGAGAAAGGCAGG - Intronic
999257049 5:150215594-150215616 CAGCCTGGGGAGAAAGAGGCTGG + Intronic
1000578685 5:163008964-163008986 CAGAGGGAGGAGAAAGAGAGTGG - Intergenic
1002213099 5:177609900-177609922 CACAGTGATCAGAGAGAGGCTGG + Exonic
1004330309 6:14715037-14715059 CACAGGGAAGGGAAAGAGGCTGG - Intergenic
1006433213 6:34011059-34011081 CAGAGAGCAGAGCAAGAGGCAGG + Intergenic
1007404390 6:41625628-41625650 GAGTGTGAACAGAAAGAGGCTGG + Intergenic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1008682830 6:53892375-53892397 CAGAGATACGAGAAAGAATCAGG - Intronic
1009435436 6:63612928-63612950 GAGAGTGAAGAGAAAAAGGTGGG - Intergenic
1009734954 6:67663764-67663786 CAGAGGGAAGACAAAGATGCTGG - Intergenic
1010321811 6:74519367-74519389 CAAAGTTCCTAGAAAGAGGCTGG - Intergenic
1011025804 6:82868038-82868060 CTGAGTGACGAGAAAAAGAATGG - Intergenic
1011700390 6:89949948-89949970 GAGAGGGAGGAGAAAGAGGGGGG + Intronic
1011969903 6:93210171-93210193 CAGAGTGTGAAGAAAGTGGCAGG + Intergenic
1015893714 6:137995893-137995915 CAGATTGAAAAGGAAGAGGCAGG + Intergenic
1015994950 6:138987967-138987989 GAGGGTGCAGAGAAAGAGGCGGG + Exonic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016389220 6:143558393-143558415 CATAGTAACGGGAAAGAGGTAGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017585460 6:155917045-155917067 CAATATGATGAGAAAGAGGCAGG + Intergenic
1017616359 6:156250703-156250725 AAGAGTGAGGAGAAAGAGACTGG - Intergenic
1017728703 6:157295407-157295429 AAGAGTGAAGAGAAAGAACCAGG - Intronic
1019088493 6:169503126-169503148 CAGAGTGACGAGAAAGAGGCAGG + Intronic
1019564082 7:1671004-1671026 CAGAGGGACGAGGACGAGGATGG - Intergenic
1020526847 7:9273019-9273041 GAAACTGACTAGAAAGAGGCAGG - Intergenic
1021936713 7:25638605-25638627 CAGAGTGATGACAAGGAGACTGG - Intergenic
1022258852 7:28685043-28685065 CAGAGTGAGGAAAAACAGCCTGG - Intronic
1022561618 7:31355477-31355499 CTGAGTGATGTAAAAGAGGCTGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1026923822 7:74174836-74174858 CAGAGGGCCGCGAAAGAGGCCGG - Intronic
1027219511 7:76204956-76204978 CTGAGTGAGGAGAAAGGAGCTGG - Intronic
1028170641 7:87591399-87591421 AAGAGGGATGATAAAGAGGCAGG + Intronic
1029616625 7:101663268-101663290 AAGGGTGCCGGGAAAGAGGCAGG + Intergenic
1030112451 7:106038423-106038445 CAGAGTGATGAGCATGAGGCTGG + Intergenic
1030280583 7:107770552-107770574 CAGAGTTAAGAAACAGAGGCTGG - Intronic
1030464431 7:109882051-109882073 CAGAGTGACAAGGAAGATCCAGG + Intergenic
1032279728 7:130491195-130491217 CAGAGGCACAAGAAAGAGGGAGG - Intronic
1032310755 7:130784565-130784587 CAAAGTGACTGCAAAGAGGCAGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034728397 7:153361919-153361941 CAGTGTGACTAGAATAAGGCAGG - Intergenic
1034863089 7:154616787-154616809 CACAGTGACGGGAAACATGCTGG + Intronic
1034882879 7:154775924-154775946 CAGAGGGACGTAAAGGAGGCCGG - Intronic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1036582216 8:10085731-10085753 CAGACTGACTGCAAAGAGGCAGG - Intronic
1036791729 8:11725636-11725658 CAGAGTGAAGAGCGAGGGGCAGG - Intronic
1037530959 8:19773001-19773023 CAGGGAGATGAGAAAGAGGGTGG + Intergenic
1039829624 8:41202444-41202466 CAGAGTGACGAGAATGTGGGTGG + Intergenic
1040888467 8:52290579-52290601 CAGAGTTTTGTGAAAGAGGCGGG + Intronic
1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG + Intronic
1041145571 8:54872767-54872789 CAGGGTGGGGAGAAAGGGGCAGG - Intergenic
1041362334 8:57066746-57066768 AAGAATGACGAGAATGGGGCTGG - Intergenic
1044610014 8:94082208-94082230 GAGAGTGACAGGAAACAGGCCGG - Intergenic
1044965251 8:97568187-97568209 CAGGGAGAAGAGAGAGAGGCTGG + Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1046096927 8:109573600-109573622 CAAAGGGAGGATAAAGAGGCTGG - Intergenic
1047037623 8:120956724-120956746 CAGAGTGGTGGGAGAGAGGCAGG + Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1048727177 8:137400130-137400152 CAGAGGGAGGACAAAGATGCTGG + Intergenic
1050119862 9:2297154-2297176 CAGAGTGACTGGAGTGAGGCTGG + Intergenic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050367520 9:4886131-4886153 GAGACTAACCAGAAAGAGGCAGG - Intergenic
1050424722 9:5501562-5501584 CAGAGGGAAGACACAGAGGCTGG + Intergenic
1050831170 9:10015710-10015732 CAGAAAGAAGAGAAAGAGGTGGG + Intronic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1052299405 9:26936745-26936767 CAGAGCAACAACAAAGAGGCAGG + Intronic
1055023530 9:71695166-71695188 CAGAGTGGCAAGGAAGAGGGTGG - Intronic
1059976442 9:119722885-119722907 CTGAGAGAAGAGAAAGAGGGAGG - Intergenic
1061893535 9:133635229-133635251 CAGAGAGACGAGAAACAGGAGGG + Intergenic
1185940591 X:4314664-4314686 CAGAGAGAAGAGAGAGAGACAGG + Intergenic
1187362337 X:18640529-18640551 CATAGGGACTAGAAAGATGCTGG + Exonic
1190656554 X:52617870-52617892 CAGAGGGCAGAGAAAGAGGTAGG - Intergenic
1192205464 X:69093137-69093159 CAGAGTGATGAGGCAGAAGCTGG + Intergenic
1192225255 X:69222996-69223018 CAGAGTGAGCAAAATGAGGCAGG + Intergenic
1194260875 X:91694065-91694087 CAGAGAGATGAGAAAGCAGCAGG - Intergenic
1194742691 X:97594231-97594253 CACAGTGAGGAGAAAGAATCTGG + Intronic
1195101139 X:101555012-101555034 GGGAGTGACGAGAGAGAGTCAGG + Intergenic
1195750379 X:108157885-108157907 TAAAGTGAAGAGAAACAGGCAGG - Intronic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1197991413 X:132322149-132322171 CACAGAGACCAGAAAGAGCCAGG - Intergenic
1198147346 X:133870646-133870668 TCAAGTGAAGAGAAAGAGGCAGG - Intronic
1199870249 X:151892003-151892025 CTAAGTGATGAGAAAGAGCCAGG - Intergenic
1200242771 X:154506561-154506583 CAGTGTTACGAAAAGGAGGCGGG + Exonic
1200579527 Y:4932867-4932889 CAGAGAGATGAGAAAGCAGCAGG - Intergenic
1202024909 Y:20511233-20511255 CACAGTCACAACAAAGAGGCAGG - Intergenic