ID: 1019089667

View in Genome Browser
Species Human (GRCh38)
Location 6:169518113-169518135
Sequence GACCCAATGGCTGCTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 1, 2: 15, 3: 130, 4: 362}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019089659_1019089667 15 Left 1019089659 6:169518075-169518097 CCTTGGGAAGTTCTGCCCCTATG 0: 1
1: 5
2: 66
3: 416
4: 888
Right 1019089667 6:169518113-169518135 GACCCAATGGCTGCTCTCACAGG 0: 1
1: 1
2: 15
3: 130
4: 362
1019089664_1019089667 -1 Left 1019089664 6:169518091-169518113 CCCTATGGGTTTGCAGGCTTCAG 0: 1
1: 0
2: 7
3: 184
4: 1538
Right 1019089667 6:169518113-169518135 GACCCAATGGCTGCTCTCACAGG 0: 1
1: 1
2: 15
3: 130
4: 362
1019089663_1019089667 0 Left 1019089663 6:169518090-169518112 CCCCTATGGGTTTGCAGGCTTCA 0: 1
1: 0
2: 9
3: 171
4: 1526
Right 1019089667 6:169518113-169518135 GACCCAATGGCTGCTCTCACAGG 0: 1
1: 1
2: 15
3: 130
4: 362
1019089665_1019089667 -2 Left 1019089665 6:169518092-169518114 CCTATGGGTTTGCAGGCTTCAGA 0: 1
1: 0
2: 3
3: 41
4: 469
Right 1019089667 6:169518113-169518135 GACCCAATGGCTGCTCTCACAGG 0: 1
1: 1
2: 15
3: 130
4: 362
1019089658_1019089667 21 Left 1019089658 6:169518069-169518091 CCAAGGCCTTGGGAAGTTCTGCC 0: 1
1: 21
2: 185
3: 591
4: 1404
Right 1019089667 6:169518113-169518135 GACCCAATGGCTGCTCTCACAGG 0: 1
1: 1
2: 15
3: 130
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019089667 Original CRISPR GACCCAATGGCTGCTCTCAC AGG Intronic
900124426 1:1063162-1063184 GCCCCCCGGGCTGCTCTCACTGG - Intergenic
900334682 1:2156326-2156348 GACCCAATGCCTGCACTCAGTGG - Intronic
902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG + Intergenic
904950186 1:34231363-34231385 GACCCAATTTCTGCTCTCAAAGG + Intergenic
905496211 1:38389990-38390012 GCCCCCAGGGATGCTCTCACAGG + Intergenic
905965656 1:42093188-42093210 GTCCACATGGCTGCTCTCATGGG + Intergenic
906017118 1:42591798-42591820 GCCCCTGTGGCTGATCTCACTGG - Intronic
906183462 1:43841126-43841148 GCCCCTGTGGCTGCTCTCATGGG + Intronic
906369061 1:45236766-45236788 GCCTCTGTGGCTGCTCTCACAGG - Intronic
907162640 1:52382487-52382509 GATGCAATGTCTGCCCTCACAGG - Intronic
907497359 1:54853837-54853859 GACCCTATGACTCCTCTCCCAGG + Intronic
907601560 1:55776287-55776309 GACCCAATGACTGTCCTCATGGG + Intergenic
908176991 1:61565703-61565725 GCCCATGTGGCTGCTCTCACAGG + Intergenic
909133493 1:71768248-71768270 GTCCCTATGGCTGCTCTCATGGG - Intronic
909197397 1:72645486-72645508 TACCAAATGGCTGCTCTCACAGG + Intergenic
909503618 1:76362826-76362848 GCCCCCATGGCTGCTCTCTTGGG + Intronic
909728929 1:78870907-78870929 GCCCCCATGGCTGCTTTCATAGG + Intergenic
909833993 1:80230896-80230918 GCCCCCATGGCTGCTTTCATAGG + Intergenic
910423863 1:87100012-87100034 GCCCACATGGCTGCTCTCATGGG + Intronic
910867658 1:91802886-91802908 CACCCAATGGATTCTCTCTCTGG + Intronic
911644130 1:100320570-100320592 GTCCCCATGGCTGATCTCACAGG - Intergenic
912074118 1:105850716-105850738 GACCCTGTGGTTGGTCTCACAGG - Intergenic
912455618 1:109794866-109794888 GAGTCACTGGCTGCGCTCACAGG + Intergenic
915404443 1:155648807-155648829 GGCCCAATGTCAGCTATCACTGG - Intergenic
915719147 1:157971386-157971408 GCCCCTGTGGCTGCTCTCACAGG + Intergenic
915785294 1:158605131-158605153 GTCCCAATGGGTGCTGTCTCAGG - Intergenic
915885718 1:159718691-159718713 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
916188041 1:162152179-162152201 GGCCCAATGGTGGGTCTCACTGG + Intronic
916288069 1:163132610-163132632 GGCCCCATGGCTGCTCTCTCAGG - Intronic
916910604 1:169341625-169341647 GTCCCCATGGCTGCTTTCAAAGG - Intronic
919055927 1:192569775-192569797 GCCCAAGTAGCTGCTCTCACAGG + Intergenic
919388675 1:196954373-196954395 GCCCCCAGGGCTGCTCTCATGGG + Intronic
920646411 1:207807267-207807289 GACGGCATGGCTGCTCTCGCTGG + Intergenic
920860783 1:209704770-209704792 AAGCCAATCGCTGCTCTGACAGG + Intronic
921118977 1:212120258-212120280 AACCCAAAGGCTGGTCTCAAAGG - Intergenic
922097934 1:222458437-222458459 GCCTCCATGGTTGCTCTCACAGG - Intergenic
923139772 1:231151478-231151500 GTCCCTGTGGCTGCTCTCACAGG + Intergenic
924759184 1:246968425-246968447 TGCCCCATGGCCGCTCTCACAGG + Intronic
1063310268 10:4945579-4945601 GGCCCCATGGCTGCTTTCACTGG - Intronic
1063317031 10:5016569-5016591 GGCCCCATGGCTGCTTTCACTGG + Intronic
1066041047 10:31548285-31548307 GCCCCTGTGGTTGCTCTCACAGG - Intergenic
1070245907 10:74730988-74731010 GCCCAAGTGGCTGCTCTCACAGG - Intergenic
1070739506 10:78893440-78893462 GAGCCATTGCCTGGTCTCACCGG + Intergenic
1071203887 10:83252374-83252396 GCTCCTGTGGCTGCTCTCACAGG + Intergenic
1072295965 10:94009830-94009852 GTACCCATGGCTGCTCTCGCAGG + Intronic
1073081619 10:100864405-100864427 AACCCTATGGCTGACCTCACTGG - Intergenic
1073342111 10:102753158-102753180 CACTCAGTGGCTGCTCTTACTGG - Intronic
1073979923 10:109142838-109142860 TCCCCCAAGGCTGCTCTCACAGG - Intergenic
1074226502 10:111489314-111489336 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1074369717 10:112890175-112890197 GATCCATTGGCTGCTCTTCCTGG + Intergenic
1075232933 10:120699539-120699561 GAGCCAGTGGGTGGTCTCACTGG - Intergenic
1076082867 10:127599346-127599368 GTTCCAATGGCTGCTCTTGCAGG - Intergenic
1078698669 11:13660110-13660132 GCCCCCAAGGCTGCTCTCATGGG - Intergenic
1079769775 11:24444706-24444728 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1080182572 11:29442664-29442686 GTCCCAGTGGCTGCTCTCACAGG + Intergenic
1080707722 11:34713637-34713659 GCTCCCATGGCTGCTCTCAAGGG - Intergenic
1080843289 11:36004498-36004520 GCCCCCATGGCAGCTTTCACAGG + Intronic
1081045561 11:38269530-38269552 GCCCCCATGGCTGCACTCATGGG + Intergenic
1081181722 11:39992390-39992412 GCTCCCAAGGCTGCTCTCACAGG - Intergenic
1081270476 11:41077119-41077141 GTCCCCATGGCTGCTTTCATGGG + Intronic
1081325388 11:41738165-41738187 GCCCCCATAGCTGCTTTCACTGG + Intergenic
1081358566 11:42144402-42144424 GTCCCTGTGGCTGCTTTCACAGG + Intergenic
1081386676 11:42480511-42480533 TCCCCACTGGCTGCTTTCACAGG - Intergenic
1081611943 11:44568197-44568219 GAACCAATGGCTGCAGTGACTGG + Intronic
1081628632 11:44671899-44671921 GCCCCCATGGTTCCTCTCACGGG - Intergenic
1082827047 11:57587538-57587560 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1082948814 11:58788834-58788856 GCCTCCATGGCTGCTCTCATGGG + Intergenic
1082973057 11:59043675-59043697 GACACCATGGCTGCTTTCATAGG + Intergenic
1083999158 11:66286880-66286902 GTCCCACTGGCTGCCCTCACTGG + Intronic
1084838803 11:71828056-71828078 GTCCCCATGGCTGCTGTCAAGGG - Intergenic
1087412425 11:97808688-97808710 GCCCTCATGGCTGCTCTTACAGG - Intergenic
1087708449 11:101521678-101521700 GTTCCCATGGCTGCTCTCAAGGG - Intronic
1090105937 11:123853764-123853786 GCCCCTGTGGCTGCTCTCACAGG - Intergenic
1091146241 11:133282721-133282743 GACCCTGTGGCTGCTCTCACAGG - Intronic
1091316543 11:134617886-134617908 GCCCCCATGGCTGCTCTCATTGG - Intergenic
1091552944 12:1550562-1550584 GCCCCCATGGCTGCTTTCATGGG - Intronic
1091818733 12:3458715-3458737 AACTCAATGTCTGCTCTAACTGG + Intronic
1093591208 12:20904502-20904524 GTCCCCATGGCTGCTTTCATGGG + Intronic
1094064086 12:26344585-26344607 GAAACAATGGCAGCTCTCAGTGG + Intronic
1094471305 12:30804173-30804195 GCCCCCATGGCTGCTCTTAAGGG + Intergenic
1095838785 12:46669395-46669417 GCCCCAGTGGCTGCTCTCACAGG + Intergenic
1097136916 12:56864724-56864746 GCTCCCATGGCTGCTCTCAAGGG - Intergenic
1097513141 12:60568270-60568292 GCCCCCATGGCTGCTCTCATTGG - Intergenic
1098559060 12:71851814-71851836 GCCCCTGTGGCTGCTCTCAAGGG + Intronic
1098836422 12:75429168-75429190 GGCCCTGTGGCTGCTTTCACAGG - Intronic
1098939484 12:76518385-76518407 GCTCCCATGGCTGCTCTCACAGG + Intronic
1099229249 12:80003425-80003447 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
1099475558 12:83104158-83104180 GCCCCAGAGGCTGTTCTCACAGG + Intronic
1099495739 12:83343632-83343654 GTCCCCATAGCTTCTCTCACAGG - Intergenic
1099724829 12:86412326-86412348 GCCCCTATGGCTGCTCTCAAGGG - Intronic
1100275827 12:93071049-93071071 GAGTCAATGGCTTCTGTCACTGG - Intergenic
1100376148 12:94017900-94017922 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1102431731 12:112889313-112889335 GACCCAAAGGCTGATGACACAGG - Intronic
1102930473 12:116858242-116858264 GCCCCAATGGCTGCTGTCCATGG - Exonic
1103358058 12:120336380-120336402 GCCCCCATGGCTGCTTTCAGGGG + Intergenic
1103367577 12:120394449-120394471 GGCGAAAAGGCTGCTCTCACCGG - Intergenic
1103599250 12:122043767-122043789 AACCCCATGGCAGCTCTCCCGGG - Intronic
1103958973 12:124595563-124595585 GACCCGAGGGCTTCTCTCCCGGG - Intergenic
1103993596 12:124815114-124815136 GACCCACTGGCTTCCCCCACAGG - Exonic
1104627521 12:130370786-130370808 GACCCACTCGCTGCCCCCACAGG + Intronic
1104666812 12:130653451-130653473 GCTCCCACGGCTGCTCTCACAGG + Intronic
1105256513 13:18746912-18746934 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1105256934 13:18749977-18749999 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1105259163 13:18766181-18766203 GCCCCCATGGATGCTCTCATGGG - Intergenic
1105259614 13:18769352-18769374 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1105261842 13:18785500-18785522 GCCCCCATGGCTACTCTCATGGG - Intergenic
1105262290 13:18788669-18788691 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1105264198 13:18802089-18802111 GCCCCCATGGCTACTCTCATGGG - Intergenic
1105734643 13:23255194-23255216 GTCCCAGTGGCTTCTCTCATGGG - Intronic
1106338910 13:28809619-28809641 ACCCCCATGGCTGCTCTCATGGG - Intergenic
1106614775 13:31316278-31316300 GCCCCTGTGGCTGCTTTCACAGG - Intronic
1108612463 13:52097371-52097393 GCCCCTGCGGCTGCTCTCACAGG - Intronic
1108710485 13:53028121-53028143 GACCCAGTGCCCGCTCTCCCAGG - Intergenic
1108771018 13:53700351-53700373 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1111207222 13:85027075-85027097 TCCCCAATAGCTGCTCTCAGGGG + Intergenic
1111207849 13:85035585-85035607 GTCACCATGGCTGCTCTCATAGG - Intergenic
1111318108 13:86586882-86586904 GGCCCCATGGCTGCTTTCACAGG - Intergenic
1112006608 13:95259046-95259068 GACACAATGACAGATCTCACAGG + Intronic
1114228676 14:20761270-20761292 CATCCAATGGCTGGTCTGACAGG - Intergenic
1116364385 14:44041250-44041272 GCTCACATGGCTGCTCTCACAGG - Intergenic
1116383114 14:44296830-44296852 GCCCCCACGGCTGCTCTCACAGG + Intergenic
1117626040 14:57639056-57639078 GACCCAATGCCTTCACTTACAGG - Intronic
1117881890 14:60320420-60320442 GCCCCCATGGCTGCTCTCACAGG - Intergenic
1117886785 14:60372212-60372234 GCCCCCACGGCTGCTCTCATGGG - Intergenic
1118092450 14:62497466-62497488 GCCCCCATGGGTGCTTTCACAGG + Intergenic
1118691450 14:68344234-68344256 GACCCCATGACTGCTCTCATGGG - Intronic
1120068800 14:80078978-80079000 GACCCAATCCTTGCTCTCAATGG + Intergenic
1120230607 14:81836844-81836866 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1120268232 14:82277696-82277718 GACCCCATGGCTGCTCTCACAGG - Intergenic
1120270706 14:82309876-82309898 GCCCCCCTGGCTGCTTTCACTGG - Intergenic
1120389550 14:83888521-83888543 GACCCCATGGGTCCTCTCATGGG - Intergenic
1122205206 14:100144872-100144894 GACCCAGTGGCTGATCTCAAGGG + Exonic
1122442366 14:101740880-101740902 GCCCCCATGGCTGCTTTCACAGG + Intergenic
1123099905 14:105790617-105790639 GCCCACATGGCTGCTCTCATGGG - Intergenic
1123128179 14:105964705-105964727 GACCCCATGGCTGCTCTCATGGG - Intergenic
1202834252 14_GL000009v2_random:65952-65974 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1202835139 14_GL000009v2_random:72299-72321 GCCCCCATGGCTGCCCTCATAGG + Intergenic
1202835520 14_GL000009v2_random:75191-75213 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1123408701 15:20040861-20040883 GATCCCATGGCTGCTCTCATGGG - Intergenic
1123518032 15:21047571-21047593 GATCCCATGGCTGCTCTCATGGG - Intergenic
1124861609 15:33447521-33447543 AACCCAATGCCTGCTCTGACTGG - Intronic
1126512838 15:49500334-49500356 GCCCCCACAGCTGCTCTCACAGG - Intronic
1129812729 15:78523949-78523971 GCCCCTGTGGCTGCTCTCAAGGG + Intronic
1129850035 15:78788486-78788508 CACCCAATGGCTGCACCCAATGG + Intronic
1130179698 15:81612740-81612762 GTCCCATTGGCTGCTCCCACTGG + Intergenic
1132525758 16:413748-413770 GCCCCCATGGCTGCCCTCACAGG + Intergenic
1137231610 16:46572135-46572157 GACCCAAGGGCAGCTGTCCCTGG + Intergenic
1137566861 16:49538663-49538685 GGCCCAAGGGCTGCACTCACAGG + Intronic
1137638611 16:50009062-50009084 GCCCCCATGGCTGCTTTCATGGG - Intergenic
1138215295 16:55199523-55199545 GCCCACATGGCTGCTTTCACAGG - Intergenic
1138770066 16:59652569-59652591 GCCCATGTGGCTGCTCTCACAGG + Intergenic
1138800066 16:60016413-60016435 GCCCTTGTGGCTGCTCTCACAGG + Intergenic
1139323698 16:66135286-66135308 TACCCCATGGCTGCTATCATAGG - Intergenic
1144533676 17:16065506-16065528 GACCCAGTGGCTGCTCTCTTGGG + Exonic
1144751746 17:17653579-17653601 GCTCCCATGGCTGCTCTCATGGG + Intergenic
1144855282 17:18264100-18264122 GTCCCAGGGGCTGCTCCCACGGG - Exonic
1145746267 17:27322242-27322264 GCCCCAATGGCTGGTATTACTGG - Intergenic
1145970629 17:28954404-28954426 GCCCCAATGGCTGATGTTACAGG - Intronic
1149025138 17:52018331-52018353 GCCCCCACGGCTGCTCTCACAGG - Intronic
1149079154 17:52632949-52632971 GTCCCTGTGGCTGCTCTCACAGG - Intergenic
1150410742 17:64938937-64938959 CACCCACTGGCCGCTCCCACTGG + Intergenic
1151415674 17:73961091-73961113 GTCCCCATGGCTGCTGTCATGGG - Intergenic
1151902085 17:77022958-77022980 GTCCCCATGGCTGCTCTCACAGG - Intergenic
1154424200 18:14259472-14259494 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1154426412 18:14275449-14275471 GCCCCCATGGCTGCTCTCTTGGG + Intergenic
1154426869 18:14278674-14278696 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1154429601 18:14298208-14298230 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1154431870 18:14314554-14314576 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1154434528 18:14333766-14333788 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1156910735 18:42408721-42408743 GCCCCAGTGGCTACTCTCAAGGG + Intergenic
1158092141 18:53727187-53727209 GCTCCCATGGCTGCTCTCAAGGG + Intergenic
1158506854 18:58053972-58053994 GACCCAAAGTCTGCCCTCACCGG - Intronic
1159218533 18:65428794-65428816 GCCCCAAAGGCTGCTCTCATGGG - Intergenic
1164855409 19:31517084-31517106 GACCCACTGGCTGCTCCAGCTGG - Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1167371080 19:49082368-49082390 GCCCCAATGTCTCCTCACACAGG - Intergenic
1168655322 19:58123332-58123354 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
1202637110 1_KI270706v1_random:52158-52180 GCCCCCATGGCTGATCTCATGGG - Intergenic
1202638428 1_KI270706v1_random:61740-61762 GCCTCCATGGCTGCTCTCATGGG - Intergenic
925246593 2:2388964-2388986 GCCCCGATGGCTGTTCTCACAGG + Intergenic
925794902 2:7530892-7530914 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
925901418 2:8511821-8511843 GTCTCAAAGGCTGCACTCACAGG + Intergenic
926598302 2:14814343-14814365 GCCCCCATGGCTGCTTTCACAGG - Intergenic
930404900 2:50942456-50942478 GATCCTGTGGCTGCTTTCACAGG - Intronic
930812967 2:55561533-55561555 GCCCCCATGGCTGCTTTCATGGG - Intronic
930952114 2:57155842-57155864 GGCCCTGTGGCTGCTCTCACAGG + Intergenic
931162187 2:59704329-59704351 GCCCCCATGGCTACTTTCACAGG + Intergenic
931800874 2:65756628-65756650 GCCCCTATGGCTGCTCTCATTGG + Intergenic
932659404 2:73639416-73639438 GCCCACATGGCTGCTCTCACAGG - Intergenic
932665968 2:73699087-73699109 GCCCACATGGCTGCTCTCACAGG - Intergenic
933482016 2:82869814-82869836 GCCCCCATGGCTGCTCTCATGGG + Intergenic
933747464 2:85581528-85581550 GACCCAGTGGCTCCTCCCACTGG - Intronic
934015857 2:87881182-87881204 GTCCCCATGCCTGCTCTCACAGG + Intergenic
934491561 2:94764722-94764744 GCCCCCATGGCTGCTTTCATGGG - Intergenic
934491993 2:94767809-94767831 GCCCCCATGGCTGCTCTCATGGG - Intergenic
934493002 2:94774937-94774959 GCCCCCATGGCTGCTTTCATGGG - Intergenic
934493402 2:94777936-94777958 GCCCCCATGGCTGCTCTCATGGG - Intergenic
934891876 2:98077910-98077932 GCCCCCAAGGCTGCTCTCACCGG + Intergenic
935324648 2:101925186-101925208 GCCCCCATGGCTGCTCTCAAGGG - Intergenic
936075743 2:109400861-109400883 GCCCCAATGGCTGTTCTCTGGGG - Intronic
936777771 2:115994653-115994675 GCCCCTGTGGCTGCTCTCTCAGG - Intergenic
936837168 2:116722692-116722714 GCCCCTGTGGCTGCTCTCATGGG + Intergenic
937154881 2:119711907-119711929 CACCCACTGGCAGCTGTCACTGG + Intergenic
937327941 2:121003261-121003283 TCCCCCATAGCTGCTCTCACAGG - Intergenic
937493081 2:122389806-122389828 AGCCCCATGGCTGCTTTCACAGG + Intergenic
937827967 2:126388516-126388538 GCCCCCGTGGCTGCTTTCACAGG - Intergenic
937995377 2:127690418-127690440 GCCCACATGGCTGCTCTCAAGGG + Intergenic
938279555 2:130054278-130054300 GCCCCCATGGCTGCTCTCATGGG - Intergenic
938279858 2:130056185-130056207 GCCCCCGTGGCTGCTCTCATGGG - Intergenic
938330502 2:130444988-130445010 GCCCCCATGGCTGCTCTCATGGG - Intergenic
938330810 2:130446900-130446922 GCCCCCGTGGCTGCTCTCATGGG - Intergenic
938359135 2:130674603-130674625 GCCCCCGTGGCTGCTCTCATGGG + Intergenic
938359443 2:130676515-130676537 GCCCCCATGGCTGCTCTCATGGG + Intergenic
938435536 2:131281252-131281274 GCCCCCGTGGCTGCTCTCATGGG + Intronic
938435841 2:131283164-131283186 GCCCCCATGGCTGCTCTCATGGG + Intronic
939125429 2:138172322-138172344 GCCCCCATGGCTTCTCTCATGGG - Intergenic
939243656 2:139594854-139594876 GCCCCCACAGCTGCTCTCACAGG - Intergenic
939278990 2:140038480-140038502 GCCCCCATGGCTGCTTTCATGGG + Intergenic
940451531 2:153843969-153843991 TAACCTGTGGCTGCTCTCACAGG + Intergenic
942494553 2:176526085-176526107 GACCCAGCTGCTGCTCTCAAAGG - Intergenic
942991568 2:182208630-182208652 GCCCCCATGGCTGCTTTCACTGG - Intronic
943143996 2:184018664-184018686 GCCCCTTTGGCTGCTTTCACGGG - Intergenic
943153917 2:184149221-184149243 AGCCCCATGGCTGCTTTCACAGG + Intergenic
943297910 2:186161325-186161347 GCCTCCATGGCTGCTTTCACGGG - Intergenic
943395599 2:187329036-187329058 GGCCCCATGGCTCCTTTCACAGG - Intergenic
943481739 2:188427938-188427960 GCCCCCATGGCTACTCTCAAGGG - Intronic
943705209 2:191026946-191026968 AGGCCACTGGCTGCTCTCACAGG - Intergenic
943889702 2:193271274-193271296 GCCCCCATGGCTGTTCTAACAGG + Intergenic
944160282 2:196652550-196652572 GCCTCCATGGCTGCTCTCAAGGG + Intronic
945900715 2:215534409-215534431 GCCCCCAAGGCTGCTTTCACAGG - Intergenic
946781494 2:223196419-223196441 GACCCAAAGGGAGCTTTCACTGG - Intronic
947183299 2:227431933-227431955 GCCCCCATGGCTGCTCTCATGGG + Intergenic
947249879 2:228090126-228090148 GCCCCCATGGCTACTCTCACAGG - Intronic
947582867 2:231332545-231332567 GAGCCAACGGGAGCTCTCACAGG - Intronic
1169198160 20:3694357-3694379 GACCCGAAGGCAGCTCTCCCAGG - Exonic
1170122073 20:12922672-12922694 GCCCCTGTGGCTGCTCTCATGGG - Intergenic
1171883268 20:30633181-30633203 GCCCCCATGGCTGCTGTCATGGG - Intergenic
1171884068 20:30639140-30639162 GCCCCAATGGCTGCCCTCATAGG - Intergenic
1173314739 20:41932961-41932983 GCCCCCAAGGCTGCTCTCATGGG - Intergenic
1174965360 20:55208083-55208105 GATCCCATGGTTGCTCTCAAGGG - Intergenic
1175634229 20:60567200-60567222 GATCCAATGGCCGCACTCAGCGG + Intergenic
1176111983 20:63415117-63415139 GACCTTCTGGCTGCTCCCACGGG + Exonic
1176842510 21:13851940-13851962 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1176842922 21:13855028-13855050 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1176845621 21:13874375-13874397 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1176847897 21:13890765-13890787 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1176848354 21:13893929-13893951 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1176849271 21:13900524-13900546 GGCCCCATGGCTGCTCTCATGGG - Intergenic
1177328801 21:19629310-19629332 GCCCCCATGGCTGCTTTCACAGG - Intergenic
1177734530 21:25072627-25072649 ACCCCCATGGCTGCTCTCAAGGG + Intergenic
1177767390 21:25474057-25474079 GCCACCATGGCTGCTTTCACAGG - Intergenic
1177835691 21:26184297-26184319 GCCCTCATGGCTGCTCTCACAGG + Intergenic
1177998380 21:28130941-28130963 GCCCCAGAGGTTGCTCTCACAGG + Intergenic
1178029224 21:28505479-28505501 GCCCCCAAGGCTGCTCTCATAGG + Intergenic
1178765887 21:35450642-35450664 GCCCCTGTGGCTGCTCTCACAGG + Intronic
1179272937 21:39865700-39865722 GACCCCATGGAGGCTCACACTGG + Intergenic
1179921585 21:44510410-44510432 GTCCCAGTGGTTGCTGTCACGGG - Intronic
1180140672 21:45891916-45891938 GACTCAGGGGCTGCTCCCACTGG - Intronic
1180363539 22:11920148-11920170 GCCTCCATGGCTGCTCTCACGGG + Intergenic
1182126647 22:27820946-27820968 AACCCAATGCCTGGTCCCACAGG + Intergenic
1182945356 22:34316592-34316614 GCCCCCATAGCTGCTTTCACAGG - Intergenic
1184318489 22:43719147-43719169 CGCCCTGTGGCTGCTCTCACAGG + Intronic
1185176620 22:49331013-49331035 GACCTAAAGGCTGTTCTGACCGG - Intergenic
949119344 3:366871-366893 GAACCACTGTCTGCTCCCACTGG + Intronic
949612338 3:5715545-5715567 GCCCCTGTGGCTGCTCTCATGGG - Intergenic
949762614 3:7487915-7487937 GCCCATATGGCTGCTCTCAAAGG - Intronic
951100678 3:18684537-18684559 GACCCCTTGGCTGCTTTCATGGG - Intergenic
951241155 3:20287711-20287733 TCCCCCATGGCTGCTCTCACAGG + Intergenic
952139205 3:30459407-30459429 GCCCCCATGGCTGCTGTCACTGG - Intergenic
952681669 3:36100445-36100467 GCCCTAATAGCTGCTTTCACAGG - Intergenic
953094938 3:39766103-39766125 GCTCCCATGGCTGCTCTCAAGGG + Intergenic
953419861 3:42746181-42746203 GTCCCAAGGGCAGCTCTCCCTGG + Intronic
953835391 3:46338826-46338848 GCCCCCATGGCTGCTTTCACAGG + Intergenic
958710274 3:97709194-97709216 GCCCCATTGGCTGCTTTCACAGG - Intronic
958837163 3:99158997-99159019 GCCCCCATGGCTGATCTCAAGGG + Intergenic
958841373 3:99209437-99209459 GCCCCCGTGGCTGCCCTCACAGG + Intergenic
958927976 3:100179649-100179671 GTCCCCATGGTTGCTTTCACAGG + Intergenic
959023467 3:101214408-101214430 GGCCCCATGGCTGGTTTCACAGG - Intergenic
959283687 3:104379999-104380021 GCCTACATGGCTGCTCTCACAGG - Intergenic
959935337 3:112022949-112022971 GCCCCTGTGGCTGCTCTCATGGG - Intergenic
960837969 3:121926795-121926817 GCCCCTGTGGCTGCTCTCACAGG - Intronic
961029654 3:123590672-123590694 GTCCCAAAGGCTGCTTTCATGGG + Intergenic
961313642 3:126019659-126019681 GCCCCAGTGTCTGCTCTCTCAGG - Intronic
961385092 3:126518682-126518704 GACCCACAGGATGCTCTCAGAGG - Intergenic
962162440 3:133013406-133013428 AACCCTGTGGCTGCTCTCATGGG - Intergenic
963416349 3:145000397-145000419 GCCCTAATGGCTGTTCTCATGGG + Intergenic
963511815 3:146256618-146256640 GCCCCCATGGCTACTCTCATAGG + Intergenic
963683475 3:148410018-148410040 GACCCTGTGGCTACTTTCACAGG + Intergenic
964092358 3:152892179-152892201 GCCCCCACAGCTGCTCTCACAGG + Intergenic
964638766 3:158886000-158886022 GCCTCCATGGCTGCTCACACAGG - Intergenic
964974911 3:162606518-162606540 GACACCATGGCTACTTTCACGGG - Intergenic
965233932 3:166090927-166090949 GCCCCCAGGGCTGCTTTCACTGG + Intergenic
965395080 3:168153087-168153109 GCTCACATGGCTGCTCTCACAGG - Intergenic
966075916 3:175936595-175936617 GCCCCCATGGCTGCTCTCAAGGG - Intergenic
966840048 3:184081147-184081169 GGCCCCATCCCTGCTCTCACAGG + Intergenic
967208404 3:187145136-187145158 GCCCCCATGGCTGCTTTCACGGG + Intronic
967592975 3:191299819-191299841 GCCCCCGTGGCTGCTCTCAAGGG - Intronic
968350513 3:198048485-198048507 GCCCCCATGGCTGCTCTCATGGG - Intergenic
968486753 4:866644-866666 GACCCCACGGCTGCCCTCGCAGG + Intronic
969103671 4:4788988-4789010 GACCCTGAGGCTGCTTTCACAGG - Intergenic
969198477 4:5582255-5582277 GCCCCAACAGCTGCTCTCAAGGG - Intronic
969780224 4:9395540-9395562 GTCCCCATGGCTGCTGTCAAGGG - Intergenic
970142046 4:12993671-12993693 GACCACATGGCTGCTCTCACAGG + Intergenic
971969568 4:33604355-33604377 GCCCCCATGGCTACTTTCACAGG + Intergenic
972102017 4:35431852-35431874 GCCCCCATGGCTGCTTTCATGGG - Intergenic
973214982 4:47658356-47658378 GTCCCCATGGCTACTTTCACAGG + Intronic
973366926 4:49215498-49215520 GCCCCCATGGCTGCTCTCATGGG - Intergenic
973368666 4:49228083-49228105 GCCCCCATGGCTTCTCTCATGGG - Intergenic
973392383 4:49567342-49567364 GCCCCCATGGCTTCTCTCATGGG + Intergenic
973393323 4:49574015-49574037 GCCCCCATGGCTGCCCTCATAGG + Intergenic
973393694 4:49576907-49576929 GCCCCCATGGCTGCTCTCATGGG + Intergenic
973530537 4:51833232-51833254 GACCCAGTTGCTGCCCTCATGGG - Intergenic
973542306 4:51946694-51946716 GCCCCAGTGGCTGCTTTCATGGG - Intergenic
974219423 4:58947591-58947613 GCCGTAATGGCTGCTTTCACAGG + Intergenic
974624131 4:64400061-64400083 GTCCCTATGGCTGCTCTAACAGG - Intronic
975627046 4:76360471-76360493 GCCCCCATGGCTGCTTTCATGGG - Intronic
976453571 4:85219724-85219746 GCCCCAATACATGCTCTCACAGG - Intergenic
976636022 4:87287123-87287145 GCTCCCATGGCTGCTCTCAAAGG - Intergenic
977271016 4:94917362-94917384 GCCCCCATGGCTGCTCTCACAGG - Intronic
977504828 4:97888319-97888341 GCCCCCATGGCTGCTCTCAAGGG - Intronic
977707318 4:100086392-100086414 GGCCATGTGGCTGCTCTCACAGG + Intergenic
977874185 4:102129669-102129691 GGCCCCATGGCTACTCTCATGGG - Intergenic
977950577 4:102966049-102966071 AGCCACATGGCTGCTCTCACTGG + Intronic
978003666 4:103589754-103589776 GTTTCAATGGCTGCTCTCGCAGG - Exonic
978206814 4:106089869-106089891 GCCCTCATGGCTGCTGTCACAGG + Intronic
978983730 4:114983307-114983329 GCCCCCATGGCTGCTTTCACAGG - Intronic
979601468 4:122590731-122590753 GCCCACATGGCTGCTCTAACAGG + Intergenic
979775179 4:124581504-124581526 GCCCCTATGGCTGTTTTCACAGG + Intergenic
980830720 4:138127181-138127203 AACTCTGTGGCTGCTCTCACAGG - Intergenic
981356827 4:143798919-143798941 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
981368355 4:143929516-143929538 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
981378152 4:144039801-144039823 GCCCCTGTGGCTGCTTTCACAGG + Intergenic
982189019 4:152834668-152834690 GCCTCCATGGCTGCTCTCACTGG + Intronic
982390868 4:154862669-154862691 GCCTCTCTGGCTGCTCTCACAGG + Intergenic
984873753 4:184349681-184349703 CACCCCATGGCTGCTCTGCCAGG + Intergenic
985386422 4:189452638-189452660 GCCCCCATGGCTGCTCTCATGGG - Intergenic
985443165 4:189999893-189999915 GCCCCCATAGCTGCTCTCATGGG + Intergenic
1202764427 4_GL000008v2_random:138015-138037 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1202764804 4_GL000008v2_random:140904-140926 GCCCCCATGGCTGCCCTCATAGG - Intergenic
1202765764 4_GL000008v2_random:147598-147620 GCCCCCATGGCTGCTCTCATGGG - Intergenic
986099773 5:4596384-4596406 GTCCCTGTGGCTGCTTTCACAGG - Intergenic
986904966 5:12485276-12485298 GCATCAATGGCTGCTCTCACAGG + Intergenic
987003833 5:13688934-13688956 GCCCCTGTGGCTGCTTTCACGGG - Intergenic
987169663 5:15240808-15240830 GCCCCCATGGCTGCTTTCATGGG - Intergenic
987460079 5:18198428-18198450 GTCCCTGTGGCTGCTCTCACAGG - Intergenic
987590308 5:19916591-19916613 GACCCTATTGCTGCATTCACAGG - Intronic
987658463 5:20839699-20839721 GCCCCCACGGCTGCTCTCAAGGG - Intergenic
987891046 5:23879202-23879224 GACCCCATGGCTGCTCCCATGGG - Intergenic
988227133 5:28426773-28426795 TCCCCCATGGCTGCTTTCACAGG - Intergenic
988647341 5:33108761-33108783 GCCCCTGTGGCTGCTCTCATTGG - Intergenic
989291818 5:39776309-39776331 CACCCTATGGCTGCTCTTAAGGG - Intergenic
989308202 5:39981585-39981607 GTCACCATGGCTGCTTTCACAGG - Intergenic
990494639 5:56335198-56335220 GCCCCCATAGCTGCTCTCAAAGG + Intergenic
990883701 5:60568620-60568642 GCCCCCATGGCTGCTTTCACAGG + Intergenic
991122586 5:63032992-63033014 GACCCTGTGGCTGCTTTCATGGG - Intergenic
993084556 5:83348098-83348120 GCCCCCATGGCTGCTTTCATAGG + Intronic
993752818 5:91691774-91691796 GCCCCCATGGCTGCTTTCACGGG + Intergenic
994181160 5:96767925-96767947 GACCCCATTGATGCTCTCTCAGG + Exonic
996701110 5:126451105-126451127 GCCTCGCTGGCTGCTCTCACGGG - Intronic
998380872 5:141724515-141724537 GCCCCCAAGGCTGCTCTCACAGG + Intergenic
999372325 5:151063612-151063634 GACCCCCTGGCTGAGCTCACAGG - Exonic
1000825430 5:166038377-166038399 GCCCCAATGGATACTCTCTCTGG + Intergenic
1001944376 5:175766670-175766692 GCCCCCATGGCTGCTCTCAAGGG + Intergenic
1003268604 6:4588256-4588278 GACCCAGTCTCTGCTCTCAAGGG + Intergenic
1003439296 6:6124254-6124276 GCCCCCATGGCTGCTCTCACAGG - Intergenic
1003979592 6:11377336-11377358 GCCCACATGGCTGCTCTCATGGG - Intronic
1005101170 6:22173706-22173728 GCCCCCAAGGCTGCTTTCACAGG - Intergenic
1005228462 6:23671392-23671414 GCCCCCATGACTGCTCTCATAGG + Intergenic
1005265812 6:24111181-24111203 GAAACAATGGCAGCTCTAACAGG + Intergenic
1008199204 6:48565098-48565120 GAGCCCATGGCTGCTTTCACAGG - Intergenic
1009377891 6:62994219-62994241 GACCCAATGGCTGCTTTAATGGG + Intergenic
1009607743 6:65896042-65896064 TACCCCATGACTGCTTTCACAGG + Intergenic
1009967589 6:70593544-70593566 GTCCACATGGCTACTCTCACAGG - Intergenic
1010366585 6:75058768-75058790 GCCCCCATGGCTGCTTTCATGGG + Intergenic
1010659721 6:78556061-78556083 GCCCCCATGGCTGCTTTCACAGG + Intergenic
1010865779 6:80975267-80975289 GCCCTAGAGGCTGCTCTCACAGG - Intergenic
1011504606 6:88028112-88028134 GCCCCCATGGCTGCTTTCACAGG + Intergenic
1012039340 6:94184830-94184852 GCCACCATGGCTGCTCTCACAGG + Intergenic
1013381229 6:109573300-109573322 GACTCAATGGCTGCTCTCTGGGG + Intronic
1014075564 6:117230779-117230801 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1014247427 6:119082734-119082756 GCCCCCATGGCTGCTTTCATGGG + Intronic
1014374731 6:120658944-120658966 GCCCCCATGGCTGCTTTCATGGG + Intergenic
1015252628 6:131142793-131142815 GCCCCTGTGGCTGCTCTCACAGG - Intronic
1015777745 6:136831869-136831891 GTCCTTATGGCTGCTTTCACTGG + Intronic
1016261341 6:142174199-142174221 GCCCCTGTGGCTGCTCCCACAGG - Intronic
1016264282 6:142213371-142213393 GCCCCCTTGGCTGCTTTCACAGG + Intronic
1018548315 6:164962926-164962948 GTCCCTGTGGCTGCTATCACAGG - Intergenic
1018730153 6:166643899-166643921 GACACAATTCCTGCCCTCACAGG - Intronic
1019089667 6:169518113-169518135 GACCCAATGGCTGCTCTCACAGG + Intronic
1019179934 6:170180120-170180142 GGCCCAATTGCTGCTCTGCCTGG - Intergenic
1019412474 7:912300-912322 GCCTCAATGGCGGCTTTCACAGG - Intronic
1020565306 7:9787675-9787697 GTCCCTATGGCTACTCTTACAGG + Intergenic
1020668186 7:11073517-11073539 GCCCCCTTGGCTGCTCTCATGGG + Intronic
1021380100 7:19956001-19956023 TACCCCAAGGCTGCTCTTACAGG - Intergenic
1022784816 7:33627573-33627595 GCCCCCTTGGCTGCTTTCACGGG - Intergenic
1024860583 7:53835352-53835374 GACCCCATGGCTGCTCTCATGGG - Intergenic
1027395229 7:77746971-77746993 GCCCCTGTGGCTGCTCTCAAGGG + Intronic
1027528549 7:79301289-79301311 GTCCCCATGGCTGCTCTCTTAGG - Intronic
1027586629 7:80066341-80066363 GCCCCCAGGGCTGCTTTCACAGG + Intergenic
1028207282 7:88032228-88032250 GACCCAATGGCCGCTTTCACAGG - Intronic
1030701821 7:112648500-112648522 GAGCCAGTGGCTGGTCTCTCTGG - Intergenic
1032330557 7:130975201-130975223 GCCCCTGTGGCTGCTCTCAAGGG - Intergenic
1033357307 7:140610732-140610754 GTCCCAAGGGCAGTTCTCACAGG + Intronic
1033843550 7:145404035-145404057 GTACCCATGGCTGCTCTCACAGG - Intergenic
1036277648 8:7369520-7369542 GTCCCCATGGCTGCTGTCAAGGG - Intronic
1036530219 8:9578143-9578165 GCTCCCATGGCTGCTCTCAAGGG + Intronic
1037840629 8:22242908-22242930 GACCCAATGATTGCACTCATGGG + Intergenic
1040102718 8:43519588-43519610 GCCCCCGTGGCTGCTCTCATGGG + Intergenic
1040103640 8:43526479-43526501 ACCCCCATGGCTGCTCTCATGGG + Intergenic
1041331586 8:56731937-56731959 GACCCAACCGCTGCTTTCAGTGG + Intergenic
1041386718 8:57312195-57312217 GCCCCCATGGCTGCTATCAAGGG - Intergenic
1041549077 8:59079854-59079876 GCCCCTGAGGCTGCTCTCACAGG - Intronic
1041632035 8:60099339-60099361 GCCCCCATGGCTGCTTTCAGGGG + Intergenic
1041682273 8:60605522-60605544 GACCCCACCACTGCTCTCACTGG - Intronic
1041940507 8:63382122-63382144 GCCCCTTTGGCTGCTTTCACTGG - Intergenic
1042072282 8:64949289-64949311 GCCCCCATGGATGCTCTCATAGG + Intergenic
1042161894 8:65905037-65905059 GCCCCGATGGCTGCTCTTATGGG - Intergenic
1045012147 8:97967705-97967727 GCCCCCAAGGCTGCCCTCACAGG + Intronic
1046257629 8:111721892-111721914 GCCCCCATGGCTGCTTTCACAGG + Intergenic
1047428398 8:124767460-124767482 CAATCAATGGCAGCTCTCACAGG - Intergenic
1048096418 8:131300307-131300329 GCCCCTGTGGCTGCTCTCACAGG + Intergenic
1048839404 8:138551723-138551745 GCCCACATGGCTGCTTTCACAGG - Intergenic
1049000244 8:139821343-139821365 GGCCCAGGGGCTGCTCTCCCAGG + Intronic
1049202879 8:141350477-141350499 GTCCGAAGGGCAGCTCTCACCGG + Intergenic
1049214536 8:141401691-141401713 GAGCCGATGGCTGTCCTCACAGG - Intronic
1049356450 8:142191450-142191472 GTCCCAATGGCTGTCATCACAGG - Intergenic
1049373165 8:142277279-142277301 GTCCCAAAGGCTGCTCTCTCTGG - Intronic
1049915327 9:311932-311954 GACCCACTGTTTTCTCTCACAGG + Exonic
1051127617 9:13821863-13821885 GCCCCCATGACTGCTCTCACAGG - Intergenic
1052004596 9:23330676-23330698 GGCCCCATGGCTGCTCTCACAGG - Intergenic
1052175948 9:25463294-25463316 GACCCCATGGCTGTTTTCACAGG + Intergenic
1052314020 9:27097629-27097651 GCCTCTGTGGCTGCTCTCACAGG - Intergenic
1052878896 9:33588078-33588100 AGCCCCATGGCTGCTCTCATGGG + Intergenic
1052879770 9:33594271-33594293 GCCCCTGTGGCTGCTCTCATGGG + Intergenic
1053495750 9:38546909-38546931 GCCCCCATGTCTGCTCTCATGGG - Intronic
1053496211 9:38549958-38549980 GCCCCTGTGGCTGCTCTCATGGG - Intronic
1053497075 9:38556141-38556163 AGCCCCATGGCTGCTCTCATGGG - Intronic
1053616340 9:39770308-39770330 GCCCCCATGGCTGCTTTCACAGG + Intergenic
1053663671 9:40302105-40302127 GCCCCCATGGCTGCTCTCATGGG + Intronic
1053666016 9:40318087-40318109 GCCCCCATGGCTGCTGTCATGGG + Intronic
1053666439 9:40321146-40321168 AGCCCCATGGCTGCTCTCATGGG + Intronic
1053898109 9:42764972-42764994 GCCCCCACGGCTGCTTTCACAGG - Intergenic
1053914184 9:42932647-42932669 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1053915595 9:42943132-42943154 GCCCCCATGGCTGCTGTCATGGG + Intergenic
1053916025 9:42946192-42946214 AGCCCCATGGCTGCTCTCATGGG + Intergenic
1054237177 9:62572081-62572103 GCCCCCATGGCTGCTTTCACAGG - Intergenic
1054375795 9:64448338-64448360 GCCCCCATGGCTGCTCTCATGGG + Intergenic
1054377171 9:64458115-64458137 GCCCCCATGGCTGCTGTCATGGG + Intergenic
1054377591 9:64461174-64461196 AGCCCCATGGCTGCTCTCATGGG + Intergenic
1054518170 9:66055137-66055159 AGCCCCATGGCTGCTCTCATGGG - Intergenic
1054518594 9:66058196-66058218 GCCCCCATGGCTGCTGTCATGGG - Intergenic
1054520944 9:66074180-66074202 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1054551313 9:66606592-66606614 GCCCCCATGGCTGCTTTCACAGG - Intergenic
1055180437 9:73380241-73380263 GCCCCTATGGCTTCTTTCACAGG + Intergenic
1055698692 9:78917556-78917578 GCCCCTGTGGCTGCTTTCACAGG - Intergenic
1056312313 9:85352911-85352933 GCTCCAGTGGCTGCTCTCACAGG + Intergenic
1056585867 9:87926721-87926743 GCCCCCATGGCTGCTCCCATGGG - Intergenic
1056611017 9:88126222-88126244 GCCCCCATGGCTGCTCCCATGGG + Intergenic
1057300216 9:93874219-93874241 GCCCCCAGGGCTGCTCTCATAGG + Intergenic
1057332554 9:94129260-94129282 GCCCCCATGGCTACTCTCACAGG - Intergenic
1057675684 9:97134424-97134446 GCCCCCATGTCTGCTCTCATGGG - Intergenic
1057676133 9:97137496-97137518 GCCCCTGTGGCTGCTCTCATGGG - Intergenic
1057676989 9:97143697-97143719 GCTCCCATGGCTGCTCTCATGGG - Intergenic
1058385409 9:104429714-104429736 ACCCCCATGGCTGCTTTCACAGG - Intergenic
1059674943 9:116529166-116529188 GCCCCCATGGCTACTTTCACAGG - Intronic
1060492669 9:124096438-124096460 GCTCCAAAGGCTGATCTCACGGG - Intergenic
1061537252 9:131257848-131257870 GACCGCAGGGCTGCTCTCGCTGG + Intergenic
1061801230 9:133114390-133114412 GACCCCAGGGCAGCTCTCTCTGG - Intronic
1203545175 Un_KI270743v1:122902-122924 GCCCTCATGGCTGCTCTCATGGG - Intergenic
1203545553 Un_KI270743v1:125792-125814 GCCCCCATGGCTGCCCTCATAGG - Intergenic
1203546514 Un_KI270743v1:132488-132510 GCCCCCATGGCTGCTCTCATGGG - Intergenic
1186576353 X:10770330-10770352 CACACAATGGCTTCACTCACTGG + Intronic
1187574813 X:20542766-20542788 GCCCCCGTGGCTGCTTTCACGGG - Intergenic
1188016332 X:25111825-25111847 GCCCCCATGTCTGCTCTCACAGG + Intergenic
1188849088 X:35110231-35110253 GCCCACATGGCTGCTCTCATGGG + Intergenic
1189127294 X:38461950-38461972 GCCCATATAGCTGCTCTCACTGG + Intronic
1190466200 X:50726976-50726998 GCCCCCATGGCTGCTTTCATGGG - Intronic
1190703547 X:53006262-53006284 GCCCCTGTGGCTGCTGTCACAGG + Intergenic
1190772578 X:53527419-53527441 GCCCCCACGGCTGCTTTCACAGG - Intergenic
1192696017 X:73416808-73416830 GCTCCCATGGCTGCTCTCACAGG + Intergenic
1193066434 X:77265153-77265175 GACCCCATGGTTGCTTTCATGGG - Intergenic
1193406486 X:81107705-81107727 GCCCCAGAAGCTGCTCTCACGGG - Intergenic
1193489654 X:82133744-82133766 GCCCCAGTGGCTGCTTTCATGGG + Intergenic
1193520022 X:82518565-82518587 GCTCCCATGGCTGCTTTCACAGG + Intergenic
1193770342 X:85580639-85580661 GCCCCTATGGCTGCTCTCAGAGG + Intergenic
1193801950 X:85946853-85946875 GCCCCTGTGGCTGCTCTCACAGG - Intronic
1193900207 X:87167401-87167423 GCCCATATGGCTGCTCTCACAGG + Intergenic
1193900211 X:87167459-87167481 GCCCATATGGCTGCTCTCACAGG + Intergenic
1193911225 X:87309258-87309280 GCCCCCTTGGCTGCTTTCACAGG + Intergenic
1194038808 X:88914918-88914940 GTCCCCATGGCTGCTTTCATGGG + Intergenic
1194878194 X:99216272-99216294 AAACCAATGGATGCTGTCACAGG - Intergenic
1195035148 X:100965514-100965536 GCCTCTGTGGCTGCTCTCACGGG - Intergenic
1195967161 X:110439164-110439186 GCTCCAATGGCTGCTCACAAAGG - Intronic
1196066601 X:111471161-111471183 ACCCCCATGGCTGCTCTTACGGG + Intergenic
1196168875 X:112565454-112565476 TCTCCAATGGCTGCTCTCAAGGG + Intergenic
1197094247 X:122574542-122574564 GCCCCCATTGCTGCTCTCATGGG + Intergenic
1197385546 X:125796601-125796623 GCCCCTATGTCTGCTCTCACAGG - Intergenic
1197524821 X:127548069-127548091 GTCCCCATGGCTGCTATCAAGGG - Intergenic
1198588590 X:138150153-138150175 GCCCATGTGGCTGCTCTCACAGG - Intergenic
1199078655 X:143551943-143551965 GCCCCCATGACTGCTTTCACAGG - Intergenic
1199128635 X:144157364-144157386 GTCCCCATGCCTGCTCTCACAGG - Intergenic
1199134553 X:144234971-144234993 GCCGCCAAGGCTGCTCTCACAGG - Intergenic
1199189271 X:144951508-144951530 GCCCCTAAGACTGCTCTCACAGG + Intergenic
1199223465 X:145343831-145343853 GTCCCTGTGGCTGCTCTCAAGGG + Intergenic
1199603364 X:149556799-149556821 GCTCCCATGGCTACTCTCACTGG - Intergenic
1199647023 X:149922676-149922698 GCTCCCATGGCTACTCTCACTGG + Intergenic
1201760363 Y:17530463-17530485 GCCCCCATGGCTGCTCTCACGGG + Intergenic
1201841191 Y:18375527-18375549 GCCCCCATGGCTGCTCTCACGGG - Intergenic
1201970607 Y:19789867-19789889 GTCACCATGGCTGCTCTCAAAGG - Intergenic