ID: 1019089949

View in Genome Browser
Species Human (GRCh38)
Location 6:169520158-169520180
Sequence GCTCAGCATCACCACACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 12, 3: 41, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019089948_1019089949 -7 Left 1019089948 6:169520142-169520164 CCAAATCGGAGTGGCTGCTCAGC 0: 1
1: 5
2: 26
3: 83
4: 116
Right 1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG 0: 1
1: 0
2: 12
3: 41
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019089949 Original CRISPR GCTCAGCATCACCACACTGT AGG Intronic
904051825 1:27644365-27644387 CCACAGCATGTCCACACTGTGGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
904450077 1:30605401-30605423 ACTCAGCCTAACCCCACTGTAGG - Intergenic
909466173 1:75976616-75976638 GCACAGCAGCACCGCACTGAAGG + Intergenic
911050111 1:93663772-93663794 GCTCCTCATTACCACACTGGGGG + Intronic
911418972 1:97615391-97615413 GGTCAGAATCACCCCACTGTTGG - Intronic
916255852 1:162787618-162787640 GCTCAGCATTACCGCAGTCTCGG - Intergenic
916307600 1:163356681-163356703 TCTCAGTAACACCACTCTGTTGG + Intergenic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
917731298 1:177877451-177877473 CCTCAGCACCAGCACAATGTGGG + Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
920824738 1:209414808-209414830 CCTCCTCACCACCACACTGTGGG + Intergenic
921146356 1:212361593-212361615 GCTCTGTATCACCACACTGTGGG - Exonic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1063099000 10:2933432-2933454 GCGAAGCATCAGCACACTGGGGG + Intergenic
1066722317 10:38353287-38353309 GCTCAGCATTACCGCAGTCTCGG - Intergenic
1067173416 10:43925760-43925782 GCCCAGCACCATCACACTGGGGG + Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074826237 10:117217255-117217277 GCTGAGAATCACCGCAGTGTTGG - Intergenic
1075079279 10:119371836-119371858 GCCCAGCCTCAGCACACAGTAGG - Intronic
1076233021 10:128837904-128837926 GCTTGGCATCACTACACAGTCGG - Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1076998154 11:309123-309145 GCTCATCATCATCCCAGTGTTGG + Exonic
1077500273 11:2906904-2906926 GCTCAGCATCCTCACACTAGCGG + Intronic
1078616596 11:12871674-12871696 GGGAAGCACCACCACACTGTGGG + Intronic
1078616705 11:12872557-12872579 TTTCTCCATCACCACACTGTTGG - Intronic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1083919908 11:65776876-65776898 CCTCAGCCTCACCAAAGTGTTGG - Exonic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1090334638 11:125954335-125954357 GCTCTGAATCACCACACTGCAGG + Intergenic
1090518727 11:127456364-127456386 GCTCAACATCACTACACATTGGG - Intergenic
1091761213 12:3088538-3088560 GCTCAGCCTGCCCCCACTGTTGG + Intronic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1093163159 12:15773000-15773022 GCTCAGCATCAGACCACAGTGGG + Intronic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1096657989 12:53103643-53103665 GCTCACCATCTCCACAGGGTTGG - Exonic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1100438134 12:94590663-94590685 GCTCAGCATGGCCCCACAGTGGG + Intronic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101884833 12:108653632-108653654 GCTCAGCATACCTAGACTGTGGG - Intronic
1102354305 12:112219955-112219977 GCCCAGCATCACAACAATGAGGG + Intronic
1102390323 12:112544391-112544413 GCTCATAATCCCAACACTGTGGG - Intergenic
1105302251 13:19146515-19146537 GCTCAGCATCACTAGTCTTTAGG + Intergenic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1113437443 13:110304382-110304404 GACAAGCATCACCACACTGAGGG + Intronic
1113892169 13:113742225-113742247 CCTCTGCATCACCCCACTGCAGG - Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1115398026 14:32932203-32932225 GCACAGCACCACCCCACAGTGGG + Intergenic
1116965706 14:51012798-51012820 GCTCAGCATCACCAGTCATTAGG - Intronic
1117464851 14:55982778-55982800 CCTCAGAATCACCACACTGGAGG - Intergenic
1117833267 14:59776115-59776137 GCTCAGCAACATCATAATGTTGG - Intronic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1118599660 14:67463071-67463093 ACTCAGGATCACCACCCTGTTGG - Intronic
1122356390 14:101125541-101125563 GTCCAGCGTCTCCACACTGTAGG - Intergenic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1128645422 15:69375252-69375274 GCACAGAGTCACCACTCTGTGGG + Intronic
1130302749 15:82692420-82692442 GCTCAGCCGCACTGCACTGTGGG + Intronic
1131305132 15:91236006-91236028 GCTCAGGATCTGCACACAGTAGG + Intronic
1131944103 15:97600203-97600225 ACTCAGCATCACCATATTGTGGG - Intergenic
1132532217 16:458078-458100 GCTCAGGAATTCCACACTGTGGG + Intronic
1136929502 16:34406588-34406610 GCTCAGCATCAGGACACCTTAGG - Intergenic
1136975072 16:35005216-35005238 GCTCAGCATCAGGACACCTTAGG + Intergenic
1137755985 16:50902641-50902663 GGTCAGCAACACCACCCAGTGGG - Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1140730404 16:77851079-77851101 GCACAGAAACACCAAACTGTGGG + Intronic
1141655830 16:85415994-85416016 GCTCACCATCGCGGCACTGTGGG + Intergenic
1142130273 16:88428954-88428976 GCTCAGCATCTCCATTCCGTGGG - Exonic
1142702181 17:1669737-1669759 GCTCAGCATCACCCCAATTCTGG + Intronic
1143014385 17:3883911-3883933 GGCCAGCCTCACCACACCGTAGG + Exonic
1143340814 17:6209595-6209617 GCTCACTATGACCACACTGTGGG + Intergenic
1143642230 17:8205583-8205605 GCCCAGCAACTCCACACTGAAGG + Intronic
1144585583 17:16485774-16485796 GCTGAGGATCCCCACACTGCGGG + Intronic
1144951301 17:18995461-18995483 ACACAGCATCAGCAAACTGTGGG + Intronic
1145228073 17:21147856-21147878 GCTCAGCAACACAACACTGTAGG + Intronic
1147950890 17:44107357-44107379 CCTCAGCCTCCCCACAGTGTTGG - Intronic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1148757268 17:49980135-49980157 CCTCAGCATCATCAAACTGGGGG - Intergenic
1149622625 17:58057479-58057501 GCTCAGATTCTCCACGCTGTAGG + Intergenic
1150483295 17:65527228-65527250 GCCCAGCACCACCACCCTCTGGG - Intergenic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1153753600 18:8258481-8258503 GCACAGGATCACCACAACGTTGG - Intronic
1154384093 18:13877949-13877971 GCTCAGCATCATCAGACTCAGGG - Intergenic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156458017 18:37305585-37305607 TCCCAGCACCACCCCACTGTGGG - Intronic
1156846242 18:41668646-41668668 TCTCACCATCTCCACGCTGTTGG + Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1158280982 18:55826052-55826074 GCTCAGCATCACCAATCATTAGG - Intergenic
1161586333 19:5107783-5107805 GCTCAGCAGGGCCACAGTGTGGG - Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1163160113 19:15459187-15459209 CCTCAGCCTCACCAAAGTGTGGG + Intronic
1164708426 19:30337252-30337274 GCTCAGCAACCCCACTCTGTGGG - Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
927903577 2:26841270-26841292 GCCCACCATCTCCACACTCTGGG + Intergenic
928596445 2:32863567-32863589 GCTCAGCATCTCTACAAAGTGGG - Intergenic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
935331113 2:101978759-101978781 GCCCAGCATCTCCACCCTGCTGG + Intergenic
937522706 2:122731780-122731802 GCTGTTCATGACCACACTGTTGG + Intergenic
938768185 2:134477820-134477842 GTACAGCTTCACCACTCTGTGGG - Intronic
939023335 2:136984192-136984214 GTACAGCTTCACCACTCTGTGGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
942813536 2:180024416-180024438 TCTCACCATCCCCATACTGTAGG - Intergenic
945122990 2:206477426-206477448 GCTCAGAATTACCACCCTGAAGG - Intronic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
946263562 2:218518837-218518859 ATGCAGCATCATCACACTGTGGG - Intronic
947818973 2:233057668-233057690 GCTCAGCATCACCACATGGATGG - Intergenic
948084528 2:235236352-235236374 TCTCAGCATTACTACATTGTTGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1168920086 20:1525273-1525295 GCTCTTCATCACAACACTATTGG - Intergenic
1170432993 20:16294416-16294438 GCTCAGCAACACCCCTTTGTTGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1172487473 20:35307017-35307039 GCTCTGCATCACCTAACTGGTGG - Intronic
1173044983 20:39501284-39501306 CCTCAGCATCACCAGAATATAGG - Intergenic
1173482030 20:43409324-43409346 GTTCATCATCACCACACGGGAGG + Intergenic
1175242405 20:57559502-57559524 ACTGAGCATCACGTCACTGTTGG + Intergenic
1179110117 21:38438997-38439019 GCTGAGAATCACCACACCGGGGG + Intronic
1181957282 22:26597133-26597155 GCTCAGCAAAACCACAGGGTGGG + Intergenic
1183342202 22:37287619-37287641 GCTCTGCATCTCCACACAGGTGG + Intronic
1184748488 22:46470705-46470727 GCTCAGCATTCCCATACTGGTGG - Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954711587 3:52507659-52507681 GCTCACCAGCTTCACACTGTTGG - Exonic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
961361777 3:126372708-126372730 GGTCAGCCTCAGGACACTGTGGG + Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963422278 3:145075209-145075231 GCTCAGCATATCCACAATGTAGG + Intergenic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
967178937 3:186886320-186886342 GTTCTGCATCCCCACACTGAGGG - Intergenic
969232242 4:5839852-5839874 GCCCAGCTCCACCACATTGTCGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
969890544 4:10255855-10255877 GATCAGCATCACCACACCTGTGG - Intergenic
971158632 4:24109908-24109930 GCTCAGCATCCCCACAGAGGAGG + Intergenic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
971816231 4:31493528-31493550 GCTCAACATCACCACATGCTAGG + Intergenic
972227686 4:37032745-37032767 GTTCTGCATCATGACACTGTGGG - Intergenic
973980258 4:56302808-56302830 GCTCGGCATTTCCACATTGTAGG + Intronic
977847237 4:101780441-101780463 GCTCAGCTTCATCTCACAGTGGG - Intronic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995181260 5:109232695-109232717 GCTCAGTATCAACAGTCTGTAGG + Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1001931458 5:175676035-175676057 ACTCAGCATCGGCACACTTTTGG + Intronic
1002462621 5:179382955-179382977 TCTCAACATCACCACCCTGCTGG + Intergenic
1002914947 6:1521436-1521458 GCTCAGCATCACCAGTCATTAGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1007929887 6:45680619-45680641 GCTCAACATCACCAAACATTAGG + Intergenic
1010258816 6:73791424-73791446 TCCCAGCATCCCAACACTGTGGG - Intronic
1010295865 6:74194937-74194959 GCTGAGCAGCAACACTCTGTAGG - Intergenic
1013092012 6:106908581-106908603 GCTCAGAACCACCACACTCAGGG - Intergenic
1013264182 6:108478495-108478517 GATCAACATTACCACCCTGTCGG - Intronic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1019302858 7:317461-317483 TCTCAGCCTGACCACACTGCGGG + Intergenic
1020016406 7:4834482-4834504 GCTCAGCAGCACAGCACCGTGGG + Intronic
1020976276 7:15011445-15011467 CACCAGCATCCCCACACTGTGGG + Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023734130 7:43219942-43219964 CCCCAGCAGCACCACACTGGAGG - Intronic
1023937981 7:44753092-44753114 GCTCAGCATCACTAGTCAGTGGG - Intronic
1024349793 7:48352138-48352160 ACGAAGCATTACCACACTGTAGG - Intronic
1024601174 7:50982863-50982885 ATTCAGCATCTCCACACTGAGGG - Intergenic
1024705553 7:51955279-51955301 GCTCAGCATCACTAATCAGTAGG + Intergenic
1024879964 7:54074031-54074053 GCTCAGTGTCACCCCACGGTTGG + Intergenic
1025919986 7:65902689-65902711 GCACATCATCATCAAACTGTTGG + Intronic
1029025474 7:97412838-97412860 TAACAGCATCACCACACTGTAGG + Intergenic
1029935412 7:104419794-104419816 GCTCAGGAACATCACACTGAAGG + Intronic
1036203796 8:6790949-6790971 GCCCAGGCTCACCACACTCTTGG - Intergenic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1042073582 8:64963400-64963422 GCTCAGCATCACTAAACATTAGG + Intergenic
1046941092 8:119932316-119932338 GATCTGCATAACCACACTGTGGG + Intronic
1047064526 8:121265637-121265659 CAGCAGCAACACCACACTGTGGG + Intergenic
1050564335 9:6866466-6866488 GCTCAGCAGTGCTACACTGTAGG - Intronic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1056568999 9:87799511-87799533 GCTCAGCAGCTCCACAGTGCAGG - Intergenic
1056733605 9:89185810-89185832 GATCAGCCTCACCACAGTGTTGG + Intergenic
1057335105 9:94149224-94149246 GCTCAGAAGCACCACACATTTGG + Intergenic
1058803182 9:108564913-108564935 GCCCAGCTTCAACACACTGCTGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1062211421 9:135366308-135366330 CCTCAGCATCCTCACAGTGTTGG - Intergenic
1062302316 9:135881735-135881757 GCTGATCATCTCCACAGTGTAGG + Exonic
1186994393 X:15104254-15104276 GCTCAGCATCACTACTCATTGGG + Intergenic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1190886160 X:54532151-54532173 GCTCAACACCTCCACACTGAGGG - Intronic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1194597828 X:95880833-95880855 GCTCAGCATCACAAATCTGTAGG - Intergenic
1195656184 X:107333557-107333579 TCCCAGCATCACCACATTGCTGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1197722726 X:129755985-129756007 GCTCAGCAGCCCCACCCTGGAGG + Intronic
1199133283 X:144220052-144220074 GCCCAGCAATGCCACACTGTGGG - Intergenic
1199919327 X:152381295-152381317 GCTCAGCATCACTACTCTTCAGG - Intronic
1200075580 X:153549078-153549100 GTTCAGCATCTGCACAATGTGGG + Intronic