ID: 1019094032

View in Genome Browser
Species Human (GRCh38)
Location 6:169564458-169564480
Sequence GCTGCCCTGTGCCACCGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019094032_1019094036 19 Left 1019094032 6:169564458-169564480 CCATCACGGTGGCACAGGGCAGC 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1019094036 6:169564500-169564522 TGAGAGCCTGCACTGCTTTGTGG 0: 1
1: 0
2: 1
3: 13
4: 207
1019094032_1019094038 26 Left 1019094032 6:169564458-169564480 CCATCACGGTGGCACAGGGCAGC 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1019094038 6:169564507-169564529 CTGCACTGCTTTGTGGTTCCTGG No data
1019094032_1019094035 -7 Left 1019094032 6:169564458-169564480 CCATCACGGTGGCACAGGGCAGC 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1019094035 6:169564474-169564496 GGGCAGCGGCAGGCAACACGAGG 0: 1
1: 0
2: 0
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019094032 Original CRISPR GCTGCCCTGTGCCACCGTGA TGG (reversed) Intronic
900421843 1:2559136-2559158 CCTGCCCTGTGCCTCCCTGTAGG - Intronic
900555709 1:3279366-3279388 GCTGCCCCGAGGCACCGCGAGGG - Intronic
901482979 1:9539003-9539025 GCAGGCGTGAGCCACCGTGAGGG + Intergenic
901573285 1:10179453-10179475 GCTGCCCTCTGGCACCATCATGG + Exonic
902747962 1:18485674-18485696 GCTACCTTGTTCCACCCTGATGG - Exonic
904292761 1:29498316-29498338 TCCGCCCTGGGCCACAGTGAGGG - Intergenic
904899520 1:33845869-33845891 TCTGCCCTATGCTACCTTGAGGG + Intronic
905693461 1:39958842-39958864 CCTGCCTTGTGCCACCTCGAAGG - Intronic
905706645 1:40064940-40064962 GCTGCCCTTAGCCACTGTGCTGG + Intronic
906568540 1:46817443-46817465 GCTGCCATGTACCACCATGCAGG + Intronic
909400751 1:75227095-75227117 GCTGGCATGAGCCACCGTGCTGG - Intronic
1063548081 10:7001389-7001411 GGAGCCCTGAGCCACCGTGGAGG + Intergenic
1070735401 10:78860645-78860667 GCTGACCTGTGTCACAGTGAGGG - Intergenic
1072124015 10:92429701-92429723 GCAGGCCTGAGCCACCGTGCTGG + Intergenic
1072790436 10:98313844-98313866 GCAGCCCCATGCCACCGAGATGG + Intergenic
1073582642 10:104682052-104682074 GCTGCCATGTGATACTGTGAAGG + Intronic
1076212462 10:128659385-128659407 GCAGCCCAGTGCACCCGTGAAGG + Intergenic
1076236076 10:128864683-128864705 GCTCCCCTGGCCAACCGTGAGGG + Intergenic
1076259928 10:129057396-129057418 GCTGCCCTGTGGCAGCGGGGAGG + Intergenic
1076604688 10:131681779-131681801 GCCTCCCTCTGCCACAGTGATGG - Intergenic
1076714727 10:132357983-132358005 GCTTCCCTGTGCCACCCTCTGGG + Intronic
1077962371 11:7089353-7089375 GGTGGCCTGGGCCACCTTGATGG - Exonic
1081879325 11:46434716-46434738 TCTGGCCTGTGCCCCAGTGAAGG + Intronic
1083228562 11:61300360-61300382 GCTGACCTGTGCCACCCAGGGGG - Intronic
1083829118 11:65219832-65219854 GCTGCCATGTGACACCAGGACGG + Intergenic
1084797575 11:71518879-71518901 CCTGCCCTGTGCCACCCCCACGG - Intronic
1086330905 11:85753219-85753241 GCTGCCCTGACCCACCTTTAAGG - Intronic
1089757143 11:120695358-120695380 GCTGCCATGTCCTACCGTGAAGG + Intronic
1091382581 12:71961-71983 GCTGCCCTTTGCCTTCCTGAAGG + Intronic
1096585271 12:52615818-52615840 GCTGCTCTCTGCCACAGGGAAGG - Intronic
1096695059 12:53343775-53343797 GCTGGTATGTGCCACCGTGCTGG - Intronic
1098234700 12:68407280-68407302 TCTGCCCTGGCCCACCGTGGAGG + Intergenic
1098271989 12:68778055-68778077 GCTGCAATGAGCCACCGTGATGG + Exonic
1102514659 12:113438174-113438196 GCTGCCCTGTGCAACTGTGCTGG + Exonic
1103942717 12:124509701-124509723 CCTGTCCTGTGTCACCCTGAAGG + Intronic
1104714899 12:131010184-131010206 GCTGCCATGTGCCACCTTGTTGG + Intronic
1112006467 13:95258101-95258123 GGTGCCTTGGGCCACAGTGATGG - Intronic
1113834673 13:113320750-113320772 GCTGCCCTGTGGTTCCGTGGTGG + Intronic
1114761573 14:25322084-25322106 GCTTCCCTGTGGCACAGAGAAGG + Intergenic
1117088023 14:52221139-52221161 GCTGTCCTGTGCCACCTGGCTGG - Intergenic
1117645553 14:57848269-57848291 TCTGCCCTTTGCCAGGGTGAAGG - Intronic
1117993711 14:61459213-61459235 CCTGGCCTGTGCCACCATCAAGG + Intronic
1119960165 14:78847031-78847053 GCTGCCTTGAGCAACAGTGAGGG - Intronic
1121085603 14:91143956-91143978 CCAGCTCTGTGCCACCGCGAAGG + Intronic
1122029088 14:98899594-98899616 TCTGCCCTGTGACAGCCTGAGGG + Intergenic
1123995184 15:25713280-25713302 GCTGCCTTGGGCCACAGTGGGGG - Intronic
1125550059 15:40538419-40538441 GGTGCCCTGTGACCCCTTGAGGG - Intronic
1127834045 15:62775751-62775773 GCCGCCCTGAGCCACCTTGTTGG - Intronic
1128783139 15:70376118-70376140 GCTGCCCTGAGCCATCCTCAGGG - Intergenic
1128796952 15:70473036-70473058 GCTGGCCTGTGGCACTGTGAAGG - Intergenic
1131093695 15:89642434-89642456 GCAGCCCTGCTCCACCGAGAGGG + Intronic
1131176441 15:90212232-90212254 GCTGCCCTGTCCCTCCCTGGAGG - Intronic
1132515369 16:363493-363515 CCTGTCCTGTGCCCCCGTCAGGG - Intergenic
1134232402 16:12439010-12439032 GCTGCCATGTGCAACCACGATGG - Intronic
1134833858 16:17345416-17345438 GCATCCCTGTGCCACAGAGAGGG - Intronic
1138078327 16:54064807-54064829 GCTTCCCTGTCACCCCGTGATGG - Intronic
1139741196 16:69036644-69036666 GAATCCCTGTGCCACCTTGAAGG - Intronic
1140803257 16:78508400-78508422 GCTTCCCTGGGCCACAGTGGAGG - Intronic
1141660842 16:85440721-85440743 GCCGCGCTGTGCCCCCGTGATGG - Intergenic
1142034301 16:87854152-87854174 GCTGACGGGTGCCACCGGGAGGG + Intronic
1203123091 16_KI270728v1_random:1555661-1555683 GCGGGCCGGTGGCACCGTGAGGG + Intergenic
1142597331 17:1035952-1035974 CCTGCCCTGTGCGAGCGGGAGGG + Intronic
1144776860 17:17789151-17789173 CCTGTCCTGAGCCCCCGTGAGGG - Intronic
1144939560 17:18928640-18928662 GCTGCCATGGGGCACGGTGATGG + Intronic
1146691440 17:34878923-34878945 CCTGCACTGTGCCTCCTTGATGG - Intergenic
1148738843 17:49880588-49880610 GCTGCCCTGTCCTACCGGGCTGG - Intergenic
1148779126 17:50111828-50111850 GCTTCCCTGGGCCACACTGAGGG - Exonic
1150474389 17:65463661-65463683 GATGCCCTGTGCCAAAATGAAGG + Intergenic
1151473351 17:74331385-74331407 GCTGGGCTGGGCCACCGTGAGGG + Intronic
1151625012 17:75271059-75271081 CCCGCCCTGTGCCTCCGGGAGGG - Exonic
1152111368 17:78359359-78359381 GCTGCCCGGGGCCACCCTGCCGG - Intronic
1152225977 17:79092994-79093016 GATGCCCCGTGCCACCCTGCTGG - Intronic
1157222859 18:45839802-45839824 TCTGCCCTGTGCCCCAGAGAGGG + Intronic
1160774413 19:848428-848450 CCTGCCCAGGGCCACCCTGATGG - Intergenic
1161248290 19:3267211-3267233 GCTCCCCTGTGCCAGGATGAGGG - Intronic
1161379767 19:3958812-3958834 CGTGGCCTGTGGCACCGTGAGGG - Exonic
1162524771 19:11200974-11200996 GCTGGCCTTTGCCACCGAGCAGG - Exonic
1163002416 19:14376307-14376329 GCTGCCCTCTGCAACAGGGAGGG - Intergenic
1167817517 19:51896820-51896842 GCTGCCCTGTGTCACTCAGAGGG - Intronic
1167825464 19:51968973-51968995 GCTGCCCTGTGTCACTCAGAGGG - Intronic
1167828952 19:52002123-52002145 GCTGCCCTGTGTCACTCAGAGGG - Intronic
1167832932 19:52041448-52041470 GCTGCTCTGTGTCACCTGGAGGG - Intronic
1168317744 19:55491429-55491451 CCTGCCCTCTGCCACCGGGCTGG + Intronic
930155718 2:48106067-48106089 GCTGCACTGTGCCACGCTCAGGG - Intergenic
933695796 2:85216238-85216260 GCTGCCCGGAGCCACGGGGAAGG - Intronic
934160284 2:89243275-89243297 GCTGCCCTGTGCAACCCCCAAGG - Intergenic
934206991 2:89939158-89939180 GCTGCCCTGTGCAACCCCCAAGG + Intergenic
938070315 2:128304963-128304985 ACTGCCCTGGGCCACCAGGAAGG - Intronic
938288998 2:130139765-130139787 GCCTCTCTGTGCCCCCGTGAGGG - Intronic
938467532 2:131533173-131533195 GCCTCTCTGTGCCCCCGTGAGGG + Intronic
938794401 2:134705934-134705956 GCTACCCTGTGTCACCGCCACGG + Intronic
946209207 2:218133869-218133891 GCAGCCATGTGCCACCATGCGGG - Intronic
946245543 2:218385158-218385180 GCTGCTCTGGGCCACCGTGTTGG + Exonic
946412889 2:219523883-219523905 GCTGCAGGGAGCCACCGTGATGG - Intronic
946459752 2:219858225-219858247 GCTGTCCTTTGCCACAGAGAGGG - Intergenic
948122992 2:235544611-235544633 GCTGCACTGTCCCACCTTGGTGG - Intronic
948627068 2:239275851-239275873 GGTGCCACGTGCCACCCTGAAGG + Intronic
948800489 2:240431159-240431181 GCTGCCCTCAGCCACAGTGCAGG - Intergenic
948972140 2:241437332-241437354 GCTGTTCCGTGCCACTGTGATGG + Intronic
949012235 2:241687231-241687253 GGTGCCCGCTGCCAGCGTGAGGG + Intergenic
1170535515 20:17337096-17337118 GCTGCCCTTTGGCTCCCTGAGGG - Intronic
1171106681 20:22440115-22440137 GCTCCCCTGTGCCACAGTGGTGG + Intergenic
1172882367 20:38210328-38210350 CTTGCCCAGTGCCACAGTGAGGG - Intergenic
1175129132 20:56775997-56776019 GCTGCCCTGTGTCACCCTGGGGG - Intergenic
1176282621 20:64322874-64322896 GCTGCCCTTTGCCTTCCTGAAGG - Intergenic
1180221439 21:46361112-46361134 ACTGGCCTGAGCCACCGTGCCGG - Intronic
1180612373 22:17106364-17106386 GCTGCCCTGAGCCACAGGGGTGG + Intronic
1181584626 22:23846328-23846350 ACTCCCCTGTGCCCCAGTGATGG - Intergenic
1183346602 22:37311644-37311666 GCAGCCCTGAGCCACAGGGAAGG - Intronic
1183688743 22:39376420-39376442 GCTGCTCTGCACCACAGTGAGGG - Intronic
1184188874 22:42881786-42881808 CCTCCCCTGGCCCACCGTGAGGG + Intronic
1184235437 22:43180663-43180685 GCTGCCCTGTGCCATCAGGCCGG - Intronic
1185136711 22:49077587-49077609 GCTGCCCTGTGCCGCAGGGAAGG - Intergenic
950013405 3:9739768-9739790 CCTGCCCTGTCCCACAGCGAGGG + Exonic
950419160 3:12886781-12886803 GCTGCCCAGTGCAACCAGGAGGG - Intergenic
950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG + Intronic
953570360 3:44066587-44066609 GTTGCCATGTGCAACCGTGTAGG - Intergenic
953904135 3:46859888-46859910 GCTGCCCTGAGCCACCACGGAGG + Intronic
954646235 3:52133264-52133286 GCTGCCCTCTGCTTCCGAGATGG - Intronic
955882767 3:63565396-63565418 GCTGCCCTCTGCCTCCAAGATGG + Intronic
958701867 3:97601554-97601576 GCTGCCCTATGACACCATGTTGG + Intronic
961636228 3:128334849-128334871 GCTGCCCTATACCACCATGGTGG - Intronic
962705645 3:138041079-138041101 GCTGCCCAGAGCCGCTGTGATGG - Intergenic
963301777 3:143605438-143605460 GCAGCCCTGTGCCAGTGTGTGGG - Intronic
969554921 4:7900894-7900916 GCTACCCTGAGACACCGTCAGGG + Intronic
972251665 4:37308922-37308944 GCTGCCATGTGCCCCCATCAGGG - Intronic
977928863 4:102730335-102730357 CCTTCCCTGTGCCACCTGGAGGG + Intronic
980422896 4:132586339-132586361 GCTCTCTTCTGCCACCGTGAAGG + Intergenic
983561508 4:169106387-169106409 GCTTCCCTGGGCCACACTGAAGG - Intronic
985966177 5:3340316-3340338 GGACTCCTGTGCCACCGTGAGGG - Intergenic
986254160 5:6087908-6087930 GCTACCCTCTGCCCCAGTGAGGG - Intergenic
986269105 5:6216159-6216181 GCTGCCAAGTCCCAGCGTGATGG - Intergenic
988428951 5:31096539-31096561 GTTTCCCTCTGCCACAGTGATGG - Intergenic
992487763 5:77211532-77211554 GCTGGCCTGTTCCTCCTTGAGGG + Intronic
992672877 5:79077056-79077078 GCAGCCCTGTGACACAGTGCTGG - Intronic
996404160 5:123090095-123090117 GCGGGCCTGCGCCTCCGTGAGGG - Exonic
999301949 5:150496691-150496713 ACTGCTCTGGGCCACCCTGAGGG - Intronic
1001647229 5:173290963-173290985 ACTGCCCTTTGCCACCATGAAGG - Intergenic
1002097297 5:176839114-176839136 GATGCCCTGTGCCACCTTCCAGG + Intronic
1004715437 6:18212362-18212384 GCTGCCATGTGCAACTGTGCAGG - Intronic
1006801192 6:36760653-36760675 GGTGCCCTGAGCCCCCATGATGG + Intronic
1007762000 6:44138753-44138775 CCTGCCCTGCCCCACCTTGAGGG + Intronic
1018711427 6:166500505-166500527 GATGCCCAGTGCCAACCTGAGGG - Intronic
1019094032 6:169564458-169564480 GCTGCCCTGTGCCACCGTGATGG - Intronic
1019519764 7:1455340-1455362 GCTGCCCTGTGACACCAGTATGG + Intronic
1024880565 7:54081108-54081130 ACTGCCCTGAGCCACAGTGGAGG - Intergenic
1029261271 7:99304397-99304419 GCTCCCCTTTGCCCCCGAGAGGG - Intergenic
1033366867 7:140678592-140678614 GCTGACCTGTCTCTCCGTGATGG - Intronic
1033511558 7:142064787-142064809 GCTGCCCTGTGTGACCATTATGG - Intronic
1033757389 7:144406125-144406147 GCTCCCCTCTGCCAGGGTGAAGG + Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1036706936 8:11053170-11053192 GCTGCCATGTGCCATTGTGGAGG + Intronic
1039966327 8:42286869-42286891 GGTGCCCTGTGCCACCCTGCAGG + Intronic
1043933675 8:86119021-86119043 GCTGCCCTCTGTCACTGTCATGG - Intronic
1044385956 8:91588421-91588443 ACTGAGCTGTGCCACCTTGAAGG + Intergenic
1044626552 8:94239991-94240013 GCTGGCCTGTGGCATTGTGACGG + Intergenic
1049936406 9:504886-504908 GCTGCCCTCCGCCACCGCCACGG - Intronic
1050387981 9:5110991-5111013 GCTGCCCGTTGCCAACGGGAAGG + Intronic
1056886455 9:90448399-90448421 GCTGCCATCTGCCACAGTGGTGG + Intergenic
1057484136 9:95468913-95468935 GGTGTCCTGTGTCACGGTGACGG + Exonic
1059334770 9:113562052-113562074 GCTGCCCTGCGCCATGGTGCAGG + Intronic
1061237245 9:129350315-129350337 TCTGCCCTGTGCCACACGGAGGG - Intergenic
1061366436 9:130174268-130174290 ACTCCCCTGTCCCACCATGATGG - Intronic
1062189216 9:135238885-135238907 GCTGCCCTGGGCTCCCGTGTGGG - Intergenic
1186717380 X:12266600-12266622 GCTGTGCTGTCCCACTGTGAAGG - Intronic
1201597806 Y:15691752-15691774 CCTGCTCTGTTTCACCGTGAAGG + Intergenic