ID: 1019095206

View in Genome Browser
Species Human (GRCh38)
Location 6:169574210-169574232
Sequence GAGGACCCTCAAAATGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019095206 Original CRISPR GAGGACCCTCAAAATGAGTA AGG (reversed) Intronic
903819866 1:26094054-26094076 GAGGACCCTCAAAACTGGAAGGG - Intergenic
905490564 1:38340285-38340307 GAGGACCCTTAAAATGCTTCAGG + Intergenic
906503238 1:46357643-46357665 GAGGACACTGAGAAGGAGTAAGG + Intronic
907490457 1:54805954-54805976 AAGGACCCTGAAAATGTGCACGG + Intergenic
907801641 1:57771887-57771909 GATGAACCTCAAAATTACTATGG - Intronic
909861987 1:80618539-80618561 GAGGACTCTGAAAGTGAGGAGGG + Intergenic
913437591 1:118863353-118863375 CAGGACCATCCAAATGTGTAAGG - Intergenic
915171798 1:153983194-153983216 GAGGACCCTCCAAAAGAGATGGG - Intronic
918965294 1:191338292-191338314 GATGAAGCTCAAAATGATTATGG + Intergenic
919240113 1:194903548-194903570 GAGGACCCTCAAAAAGCCTTTGG - Intergenic
920329336 1:205194253-205194275 CATGACCCTCAAGATGAGTGAGG + Intronic
1063948819 10:11203758-11203780 GATGACCCCCAAAATGGGGATGG - Intronic
1069541484 10:69297508-69297530 CAGGACTCTCACAATGAGGAGGG + Intronic
1071679934 10:87694882-87694904 GAGGAAACTCAGAAGGAGTAGGG + Intronic
1072936360 10:99717247-99717269 TGGGACCCTCAGAATGAGTGTGG - Intronic
1076532946 10:131157080-131157102 GCGGATTATCAAAATGAGTACGG - Intronic
1079049446 11:17140508-17140530 GATGAACCTCAAAAACAGTATGG + Intronic
1080189297 11:29525507-29525529 CAGTACACTCATAATGAGTATGG - Intergenic
1082299605 11:50490261-50490283 GTGGGCCCTCAAAATGTTTATGG + Intergenic
1084089859 11:66872204-66872226 GAGGCTCCTCAGAATGAGTGAGG + Intronic
1086882478 11:92165548-92165570 GTGGGCCCTCAGAATGAATATGG + Intergenic
1091581606 12:1793800-1793822 GAGGACCCTCAAAAAGGGAGGGG + Intronic
1094028529 12:25984805-25984827 GAGTACTCATAAAATGAGTAAGG - Intronic
1095312093 12:40711429-40711451 GAGGTCCCTAAAAATGTGAAGGG - Intronic
1099496262 12:83350740-83350762 CATGACCCTAAAAATGAGGATGG - Intergenic
1099954488 12:89339943-89339965 GAGGTCCCTTAAAATGATTAGGG + Intergenic
1100136120 12:91555686-91555708 GAGGACACTGAAAATGAGACAGG - Intergenic
1102586187 12:113924576-113924598 GAGAACCTTCAAAATGTGCAAGG + Intronic
1107465385 13:40645261-40645283 TAGGACCTTTAAAATGAGCAGGG - Intronic
1109427748 13:62189243-62189265 GAAGACACTGATAATGAGTAAGG + Intergenic
1110480820 13:75973879-75973901 GAAGACTCTCAAAAGGAATAAGG + Intergenic
1110913661 13:80995110-80995132 CAGAACCCTTAAAATGAGTCAGG + Intergenic
1119369096 14:74122920-74122942 GTGGACCCCCAAAAGAAGTATGG + Intronic
1119765516 14:77185204-77185226 GAGCACCCTCAAGATGAGATGGG + Intronic
1121072294 14:91035371-91035393 TGGGACACTAAAAATGAGTAGGG + Intronic
1121829976 14:97043067-97043089 GAGGCCCCTTAAAATGAAAAAGG - Intergenic
1124631314 15:31339103-31339125 GAGGACCCTGACCATGAGCAGGG - Intronic
1124692687 15:31838816-31838838 GAGGACCCTCAAAATGAGTTAGG - Intronic
1125197803 15:37068554-37068576 TAGCACCCTCATAATGAGTGCGG - Intronic
1126545327 15:49866949-49866971 AAGGATCATCAAAATGAGTTGGG - Intronic
1128441639 15:67714995-67715017 GAGGACCATCAAAAGGTGAAAGG + Intronic
1133644024 16:7745940-7745962 GAGAAACCTGTAAATGAGTAAGG - Intergenic
1135284685 16:21183170-21183192 GCTGGCCCTCAAAATGAGGAAGG - Intergenic
1138228332 16:55318737-55318759 GAGGACCCTACAGATGAGTGGGG - Intergenic
1139344872 16:66296430-66296452 GAGCACCCTCAAGATGAGGCTGG - Intergenic
1148864820 17:50623017-50623039 GAGGACCCTCCCAAGGAGCAGGG - Intronic
1149339862 17:55674190-55674212 GAGGAGCCACAAAAGGGGTAGGG - Intergenic
1157436232 18:47671802-47671824 GAGGGCACTCAGAATGAGGATGG + Intergenic
1159061232 18:63516408-63516430 GAGGACCCTAGAGATTAGTAAGG - Intergenic
1164134912 19:22405896-22405918 GTGGCCCCACAAAATGAGGAGGG - Intronic
1166752164 19:45169494-45169516 CAGGATCCTCACAAGGAGTAAGG + Intronic
929987487 2:46749662-46749684 GAAGCCCCTCCAAATGAATAAGG + Intronic
930070707 2:47363793-47363815 GAGGACTGTCAAAATGACTAAGG + Intronic
931758702 2:65397264-65397286 GAGTACCCTGAAAATGACTCAGG + Intronic
932055062 2:68434980-68435002 GAGGAGCATCAAGATCAGTATGG + Intergenic
932797631 2:74711222-74711244 GATGAATCTCAAAATGATTAAGG + Intergenic
936170760 2:110170973-110170995 GTCGCCCCTAAAAATGAGTAGGG + Intronic
936289017 2:111204432-111204454 GATCACCCTCATAATGAGGATGG + Intergenic
938055373 2:128210120-128210142 GTGCCCCCTCAAAATGTGTATGG - Intergenic
939553443 2:143644013-143644035 CATGGCCCTCAAAATGGGTAAGG - Intronic
941143229 2:161811410-161811432 GAGGAACCCCAACATAAGTATGG - Intronic
946041298 2:216784971-216784993 GAGGCCCCTCAGAGAGAGTATGG - Intergenic
1169155120 20:3323240-3323262 GAGGACCCTCAAACTGCTTCAGG - Intronic
1170535201 20:17334347-17334369 GAGGACACTGGAAATGAGCATGG + Intronic
1172489824 20:35327095-35327117 CAGGAACCTCAAGATCAGTAAGG - Intronic
1174270968 20:49368109-49368131 GATGGCCCTCAAAATCAGGATGG - Exonic
951416743 3:22433170-22433192 GAGGACCATCACCATGAGTGTGG + Intergenic
952705190 3:36370160-36370182 GAGGCACCTCAAAAAAAGTAGGG - Intergenic
952898456 3:38094709-38094731 GAGGACCCTCCAATGGAGGAGGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955020907 3:55120205-55120227 GAGGAGTATGAAAATGAGTATGG + Intergenic
955725370 3:61926804-61926826 GAGGATCCTCTAAATAATTATGG - Intronic
956395911 3:68825991-68826013 GAGGACCCTCACAACAAGCAAGG + Intronic
962171986 3:133110978-133111000 GAGAAACCTCAAAAGGACTATGG - Intronic
962403656 3:135082105-135082127 GAGGACCCTAAAACTGGGTCAGG + Intronic
964302202 3:155301038-155301060 GATGACCCTCAAAATGATCTTGG - Intergenic
964455329 3:156859227-156859249 GAAGTCCTTCAAAATGAATATGG + Intronic
967470905 3:189861002-189861024 GAGGACTCCAAAAATGAGGAAGG - Intronic
972279431 4:37588036-37588058 GAACATCCTAAAAATGAGTATGG - Intronic
980911365 4:138997672-138997694 GGGGATCCTCAACATCAGTAAGG - Intergenic
986261954 5:6155359-6155381 GTGGACCCTCAAGAAGAGGATGG - Intergenic
986914230 5:12597255-12597277 GACTTCCCTCAAAAGGAGTATGG + Intergenic
992638862 5:78751430-78751452 GAGGAGCCTCAGAATGGGAAGGG + Intronic
995188981 5:109300610-109300632 GAGGAGCCTCAGAATGAACAGGG - Intergenic
1006818410 6:36870273-36870295 AAGGGCCCTTGAAATGAGTAAGG + Intronic
1008601128 6:53096485-53096507 CAGGACCTTCCAAATGAGCAGGG - Intronic
1009863211 6:69362622-69362644 GATCACCCTCAAACTGAGTAAGG + Intronic
1013732572 6:113185669-113185691 GAGGAGCCTCAAGATGTGCAAGG - Intergenic
1014650155 6:124026269-124026291 CAGGACCCTGGCAATGAGTAAGG + Intronic
1014943033 6:127465617-127465639 GAAGACCCTGAAAATGGGTCTGG - Intronic
1019095206 6:169574210-169574232 GAGGACCCTCAAAATGAGTAAGG - Intronic
1021495456 7:21269413-21269435 GAGGAGCTTCAAAATAAATAAGG - Intergenic
1027052926 7:75031086-75031108 GAGTTCCCTCTAAAAGAGTAGGG + Intronic
1028095058 7:86749800-86749822 GAGGACTCTGAAAAGCAGTAAGG - Intronic
1033709286 7:143924043-143924065 GATGTCCTTCAACATGAGTATGG + Intergenic
1036531282 8:9590161-9590183 GAGGGCCCTGAAGATGAGTCCGG - Intronic
1037804596 8:22052016-22052038 GGGGACCCTTCAAATGAGAATGG - Intronic
1039993541 8:42511073-42511095 AAGGACCCTCAAAATGACAGTGG + Intronic
1045649226 8:104327053-104327075 GAGGCCCCTCAGGAAGAGTAGGG + Intergenic
1047718166 8:127614917-127614939 GAAGACCGTCAACATGAGAAGGG + Intergenic
1050914511 9:11114859-11114881 GAGGAACCTCAAAATATTTAGGG + Intergenic
1056016442 9:82393438-82393460 GAAGGCCCTTAAAGTGAGTATGG - Intergenic
1057874808 9:98745904-98745926 GAAGACCCTTAAAATGAGCCAGG + Intronic
1059010736 9:110456169-110456191 GAGGACCCTGAGAAAGAATATGG - Intronic
1193908956 X:87278944-87278966 GAAGACCCATAAAATGAGTTAGG - Intergenic
1194402364 X:93454483-93454505 GAGGAGCATCAAACTGAGTTTGG + Intergenic
1198734925 X:139775096-139775118 GACAACACTCAGAATGAGTAGGG - Intronic
1200056966 X:153466647-153466669 TAGGACCCTCAAAAGGCCTAAGG + Intronic