ID: 1019096578

View in Genome Browser
Species Human (GRCh38)
Location 6:169586236-169586258
Sequence GACCTCACGGGATTTATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019096578_1019096581 -9 Left 1019096578 6:169586236-169586258 CCTGTCATAAATCCCGTGAGGTC No data
Right 1019096581 6:169586250-169586272 CGTGAGGTCATGCACAACTCTGG No data
1019096578_1019096582 8 Left 1019096578 6:169586236-169586258 CCTGTCATAAATCCCGTGAGGTC No data
Right 1019096582 6:169586267-169586289 CTCTGGACAGTTCTCTCCAGTGG No data
1019096578_1019096584 21 Left 1019096578 6:169586236-169586258 CCTGTCATAAATCCCGTGAGGTC No data
Right 1019096584 6:169586280-169586302 TCTCCAGTGGGAATTGTTTCAGG 0: 1
1: 0
2: 1
3: 18
4: 196
1019096578_1019096583 9 Left 1019096578 6:169586236-169586258 CCTGTCATAAATCCCGTGAGGTC No data
Right 1019096583 6:169586268-169586290 TCTGGACAGTTCTCTCCAGTGGG 0: 1
1: 1
2: 4
3: 32
4: 190
1019096578_1019096585 22 Left 1019096578 6:169586236-169586258 CCTGTCATAAATCCCGTGAGGTC No data
Right 1019096585 6:169586281-169586303 CTCCAGTGGGAATTGTTTCAGGG 0: 1
1: 0
2: 4
3: 23
4: 228
1019096578_1019096587 29 Left 1019096578 6:169586236-169586258 CCTGTCATAAATCCCGTGAGGTC No data
Right 1019096587 6:169586288-169586310 GGGAATTGTTTCAGGGTTGATGG 0: 1
1: 0
2: 3
3: 21
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019096578 Original CRISPR GACCTCACGGGATTTATGAC AGG (reversed) Intronic