ID: 1019097156

View in Genome Browser
Species Human (GRCh38)
Location 6:169591597-169591619
Sequence TTTTAGCTATAGCTTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 297}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019097150_1019097156 14 Left 1019097150 6:169591560-169591582 CCTCCAAATGGGGACCAATGACA 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1019097156 6:169591597-169591619 TTTTAGCTATAGCTTTTTGGGGG 0: 1
1: 1
2: 1
3: 25
4: 297
1019097151_1019097156 11 Left 1019097151 6:169591563-169591585 CCAAATGGGGACCAATGACATTT 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1019097156 6:169591597-169591619 TTTTAGCTATAGCTTTTTGGGGG 0: 1
1: 1
2: 1
3: 25
4: 297
1019097152_1019097156 0 Left 1019097152 6:169591574-169591596 CCAATGACATTTTATGTTTTTGT 0: 1
1: 0
2: 7
3: 93
4: 1129
Right 1019097156 6:169591597-169591619 TTTTAGCTATAGCTTTTTGGGGG 0: 1
1: 1
2: 1
3: 25
4: 297
1019097149_1019097156 22 Left 1019097149 6:169591552-169591574 CCTAGTTACCTCCAAATGGGGAC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1019097156 6:169591597-169591619 TTTTAGCTATAGCTTTTTGGGGG 0: 1
1: 1
2: 1
3: 25
4: 297
1019097148_1019097156 23 Left 1019097148 6:169591551-169591573 CCCTAGTTACCTCCAAATGGGGA 0: 1
1: 0
2: 2
3: 8
4: 87
Right 1019097156 6:169591597-169591619 TTTTAGCTATAGCTTTTTGGGGG 0: 1
1: 1
2: 1
3: 25
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019097156 Original CRISPR TTTTAGCTATAGCTTTTTGG GGG Intronic
901484787 1:9551369-9551391 ATTTACCTATTGATTTTTGGGGG - Intronic
903890081 1:26563786-26563808 TATTAGCTTCAGTTTTTTGGGGG + Intronic
906892275 1:49730278-49730300 TTTTAGCTCCTGCTCTTTGGTGG - Intronic
907012118 1:50973279-50973301 TTGGAGCTATATCTATTTGGAGG + Intronic
908344994 1:63223043-63223065 TTTTAGTTCTAGTTTTTTTGGGG - Intergenic
908957062 1:69644991-69645013 CATTAGCTATAGATTTTTGTAGG - Intronic
909651973 1:77985686-77985708 TTTTAGTTAGAGCTTTTAAGTGG + Intronic
910510308 1:87996403-87996425 TTTTAGATATATGTTTTTGTTGG + Intergenic
910594001 1:88959155-88959177 TTGTAGTCATAGCTATTTGGGGG + Intronic
910629740 1:89342584-89342606 TTTTATCTATCCCTCTTTGGTGG - Intergenic
913038442 1:114998759-114998781 TATTAGTTATAAATTTTTGGGGG - Intergenic
915862516 1:159461210-159461232 ATTTTGGTATAGATTTTTGGTGG + Intergenic
916805516 1:168256457-168256479 TGTTAGCTATAGGTTTTTAATGG + Intergenic
917686613 1:177423126-177423148 TTTAAGCTATTAATTTTTGGGGG - Intergenic
918190157 1:182165885-182165907 TTTTATGTATAGGTTCTTGGGGG + Intergenic
918789082 1:188802279-188802301 TATTAGCTATAACTGTTTGTTGG - Intergenic
918832723 1:189418805-189418827 TGTTAGCTATATCTTTTTTCAGG - Intergenic
920860994 1:209706657-209706679 TCTTAGCTGCAGATTTTTGGGGG - Intronic
922396621 1:225208571-225208593 TTTTTACTATATCTTTCTGGAGG - Intronic
923931024 1:238697087-238697109 TTTTTTCTATATATTTTTGGGGG - Intergenic
924535938 1:244935788-244935810 TTTTTGCTAAAGATTTTTGGGGG - Intergenic
1063239910 10:4158177-4158199 TTTCAGCTACTGCTGTTTGGGGG + Intergenic
1063780653 10:9318851-9318873 TTTTAAGTATAGTTATTTGGAGG - Intergenic
1064158974 10:12927261-12927283 TTTTTGCTATAGCATTTTTAAGG + Intronic
1065147499 10:22784706-22784728 CATTAGCTGTAGGTTTTTGGTGG + Intergenic
1065344392 10:24734918-24734940 TTTTAGTTATTGGTTTATGGAGG - Intergenic
1066178979 10:32941328-32941350 TTGTAACTATATCTTGTTGGTGG + Intronic
1066364648 10:34765120-34765142 TTTGAACTGTATCTTTTTGGGGG - Intronic
1066539602 10:36431319-36431341 TTTTAACTTTAGCTGTCTGGTGG + Intergenic
1067520448 10:46997700-46997722 TTTTAACTATTGATTTTTGAGGG - Intronic
1068806702 10:61203004-61203026 TTTTAGCTATAGCTTTTTTGTGG - Intergenic
1070293887 10:75142302-75142324 TTTTCTCTTTAGCTTCTTGGTGG + Intronic
1071252489 10:83835134-83835156 TTTTAAAAATAGCTTTATGGTGG - Intergenic
1071911540 10:90240175-90240197 TTTTACGTTTAGCTTTTTGAGGG - Intergenic
1072625601 10:97109182-97109204 TTTTTTCTTTTGCTTTTTGGTGG - Intronic
1074061291 10:109968202-109968224 TTTTAGCCATATCTTTCTTGAGG + Intergenic
1074706447 10:116137106-116137128 TTTTTGCTCTAGCTGTTGGGAGG - Intronic
1074717291 10:116231392-116231414 TTTTAATTATAACATTTTGGAGG - Intronic
1074879313 10:117641348-117641370 TGTTAGCTATAGGTTTTTTTTGG + Intergenic
1075019040 10:118934941-118934963 TGTTAGCTGTAGGTTTTTGTAGG - Intergenic
1075299542 10:121309529-121309551 TTTTCGCTATAGCTTTATTAGGG - Intergenic
1076450914 10:130556402-130556424 TTATAGCGGTAGCTATTTGGGGG + Intergenic
1078128467 11:8592337-8592359 TATTAGCAAAAGCTTTTTGATGG - Intronic
1080779249 11:35415840-35415862 TTTTAGAAATATCTTCTTGGAGG - Intronic
1081217510 11:40419746-40419768 TATTAGGTACAGCCTTTTGGTGG - Intronic
1081254704 11:40877961-40877983 TTTGAGATGTAGCTTTTTGTTGG + Intronic
1081960295 11:47131105-47131127 TTTTAGCTCTAAATTTATGGGGG - Intronic
1082728875 11:56770912-56770934 TTATTTCTATAGGTTTTTGGGGG + Intergenic
1083493492 11:63030484-63030506 TTTTATCTAAAGCTCTTTTGGGG + Intergenic
1085331113 11:75652120-75652142 TTTTAGCAATAAAATTTTGGTGG + Intronic
1085590427 11:77754756-77754778 TTTTAGTTTTTGTTTTTTGGGGG - Intronic
1086024052 11:82268636-82268658 TTTTGGTTTTAGTTTTTTGGGGG + Intergenic
1086072421 11:82813978-82814000 GTTTAGCTATTCCTCTTTGGGGG - Intergenic
1086589006 11:88489445-88489467 TTTCAGCAATAGCTTTTTAAAGG - Intergenic
1086613454 11:88785504-88785526 TTTTAACTATAGATGTTTTGAGG - Intronic
1086643514 11:89189840-89189862 TTTTAGAATTAGCTTTTTGAAGG - Intronic
1088501150 11:110484452-110484474 TTTTAACAATAGCTTTATTGAGG - Intergenic
1090166004 11:124548316-124548338 TTTTAGCTGTAGGTTTTTCACGG - Intergenic
1090751087 11:129747132-129747154 CTCTAGCTTTAGCTTTTGGGTGG - Intergenic
1092506026 12:9101037-9101059 TTTTTTCCATAGGTTTTTGGGGG - Intronic
1092935608 12:13360826-13360848 TTTTAATTATATTTTTTTGGGGG + Intergenic
1093271676 12:17070099-17070121 TTGAATCTATAGATTTTTGGGGG - Intergenic
1093864762 12:24212094-24212116 TTTTAAATACAGCTTTTTGCAGG + Intergenic
1093993220 12:25613370-25613392 TTTTAGCTAGATCTTTTAGTGGG + Intronic
1094231127 12:28104551-28104573 CTTTAGCAATAGATTTTTGAAGG - Intergenic
1095377140 12:41543581-41543603 TTTTAGATATAACTTGTTGCAGG + Intronic
1095509297 12:42932604-42932626 TTTTATCTATTGATTTTTGGGGG + Intergenic
1095987095 12:48005719-48005741 TTTTGCCTATAGTTCTTTGGGGG - Intergenic
1096436741 12:51597380-51597402 TTTGTGCTATAAATTTTTGGGGG + Intronic
1097613398 12:61854304-61854326 TTTCTGCTATAATTTTTTGGGGG - Intronic
1097820320 12:64121891-64121913 ATTTAGTTATAGGATTTTGGAGG - Intronic
1098791125 12:74824414-74824436 TTTTAGTAATAGCTATTTGGAGG + Intergenic
1099685892 12:85888649-85888671 GGTTAGCTATAGGTTTTTTGTGG - Intergenic
1099724184 12:86403679-86403701 TTTTAGGTATAGATTTTGGAAGG + Intronic
1099866415 12:88287945-88287967 TTTTAGAAATATCTTTCTGGTGG - Intergenic
1101130215 12:101682187-101682209 TTTTAGTTTTTGTTTTTTGGGGG - Intronic
1101192066 12:102344531-102344553 TCTTTGCTATAGCTTTATTGAGG + Intergenic
1101450296 12:104770576-104770598 TTCTAGCTGTAGGTTTTTTGTGG + Intergenic
1103114568 12:118315709-118315731 TTTTAGATTTTCCTTTTTGGGGG - Intronic
1103723995 12:122988971-122988993 TTTTGGCTATAGCTGGTGGGGGG - Intronic
1103911071 12:124352676-124352698 TTTGAGCTATAGTATTTTAGAGG + Intronic
1105656261 13:22442640-22442662 ATTTGGCTATAGATTTTGGGAGG + Intergenic
1105905481 13:24805747-24805769 TTTTATGTTTAACTTTTTGGGGG + Intronic
1106427041 13:29641287-29641309 TATTGGCTGTAGGTTTTTGGTGG - Intergenic
1106786244 13:33110636-33110658 TGTTAGCTGTGGCTTTCTGGGGG + Intronic
1107824431 13:44315246-44315268 TTTTAGCTATTGCATTTTAAAGG - Intergenic
1108260981 13:48656098-48656120 TTTTAGCTATGTCTGGTTGGTGG + Intronic
1108811938 13:54237324-54237346 TTTCAGTTATAACTTTTTTGTGG + Intergenic
1109073185 13:57795760-57795782 TTTTAGCATTAGCTTTTTCTTGG + Intergenic
1110926147 13:81154548-81154570 TTTTAGGTAGTGTTTTTTGGGGG - Intergenic
1113022016 13:105897646-105897668 TTCTAGCTTTAGTTTTTTGAGGG - Intergenic
1113283877 13:108824250-108824272 TTTTAGCAGTAGCATTCTGGAGG - Intronic
1114940340 14:27602047-27602069 TTTTTTCTTTAGCTTTTTGAGGG - Intergenic
1115108370 14:29789374-29789396 TTTTATGGATGGCTTTTTGGGGG + Intronic
1115899934 14:38134255-38134277 TTTTACCAAATGCTTTTTGGTGG - Intergenic
1116054416 14:39845498-39845520 TTTTAGCTATGTCTTTCTGCAGG + Intergenic
1116324350 14:43512927-43512949 TTTTAGCTATTGCCATTGGGAGG + Intergenic
1116770073 14:49117126-49117148 TTTTCACTATAGTTTGTTGGAGG - Intergenic
1117583077 14:57172495-57172517 TTTTTGCTTTTGTTTTTTGGTGG + Intergenic
1117826739 14:59712065-59712087 TTTCAACTATTGCTATTTGGTGG - Intronic
1119497627 14:75094227-75094249 TTTCAGCTGTTTCTTTTTGGAGG + Intronic
1120199276 14:81518784-81518806 TTTTAGGTATGCCTTTTAGGAGG - Intronic
1121747947 14:96316338-96316360 TTTTTGCAATAGCTTTGTTGAGG - Intronic
1124162112 15:27281502-27281524 ATTTACCTATAGTTTTTAGGGGG + Intronic
1124864024 15:33471658-33471680 TTGTTGCTTTAGTTTTTTGGGGG + Intronic
1125519309 15:40339335-40339357 TTTCAGCTGTGGCTCTTTGGTGG + Intronic
1125595332 15:40881737-40881759 TTTTAGGTAAAGGTTTTAGGTGG - Intergenic
1125702981 15:41704817-41704839 TTTTGGCTATATCTTATTGTAGG + Intronic
1126484928 15:49169817-49169839 GTTTAGCTATTGCTTCTTTGCGG - Intronic
1127074829 15:55315371-55315393 TTGTTGCAATTGCTTTTTGGTGG - Intronic
1127104978 15:55604177-55604199 TGTTTGCTATAGGTATTTGGTGG + Intergenic
1127169365 15:56283756-56283778 TTTTAACTATGGTTTTTTGAAGG - Intronic
1127268239 15:57377937-57377959 TGTTAGCTTTGGCTTTTTGAAGG - Intronic
1127571569 15:60248461-60248483 CTTTTGATATTGCTTTTTGGGGG + Intergenic
1129939738 15:79484956-79484978 TATTTGTTATAACTTTTTGGTGG + Intergenic
1130824959 15:87534231-87534253 TTTTAGATATGGCTGTCTGGTGG - Intergenic
1132296775 15:100741930-100741952 TGTTTGCTGTAGCTTTTTGTAGG + Intergenic
1133466939 16:6036402-6036424 TTTTTGCCATTGCTTTTTTGGGG + Intronic
1133476051 16:6123097-6123119 TTTTAGGTGTAGCCTTTTGAGGG - Intronic
1133476132 16:6123891-6123913 TTTTAGCTATTCTTTTTTTGAGG - Intronic
1134421875 16:14100224-14100246 TGTTAGCTATAGGTTTATTGTGG + Intronic
1135274835 16:21103293-21103315 TTTTTTCCATAGGTTTTTGGGGG - Intronic
1135344605 16:21678196-21678218 TTTTGACTATACCTTTTTGCTGG + Intergenic
1137566977 16:49539401-49539423 ATTCAGCTATAGCTTTCTGGTGG + Intronic
1139218201 16:65150421-65150443 TTTTAAATATAGCTTTTTACGGG - Intergenic
1139316449 16:66074582-66074604 TTTTAGCTATAAATTTTTTTCGG - Intergenic
1140846863 16:78897847-78897869 TTTTAATTATAGCCTTTTTGTGG + Intronic
1142391535 16:89804179-89804201 TTTTTCCTAAAGCTTTTTGGTGG - Intronic
1146500419 17:33359641-33359663 TTTTGGCTAGAGCTTTTAGATGG - Intronic
1148658958 17:49312079-49312101 TTTTAGTTTGAGCTTTTTGGTGG - Intronic
1148933574 17:51146892-51146914 TTTTGTTTATAGCTTTTTAGAGG + Intergenic
1149226236 17:54474266-54474288 TTTTTGCTTTTGTTTTTTGGTGG + Intergenic
1149823516 17:59803958-59803980 GTTTTGGTTTAGCTTTTTGGTGG + Intronic
1150469940 17:65428670-65428692 TTATTTCTATAGGTTTTTGGGGG - Intergenic
1150946539 17:69752159-69752181 TTTTACCTATGGCTTTTTAAAGG + Intergenic
1151005313 17:70429392-70429414 TGTTAGCTATAGGATTTTTGTGG - Intergenic
1155152559 18:23134920-23134942 TGTTAGCGATAGCTTTACGGTGG + Intronic
1157040784 18:44036583-44036605 GTTTAGATATAGCTCCTTGGTGG - Intergenic
1158399241 18:57105963-57105985 TTGGAGCTAGAGCTTTTAGGAGG - Intergenic
1158599356 18:58843801-58843823 TTTTAATTATAGGGTTTTGGGGG - Intergenic
1159747628 18:72257668-72257690 GATTAGCTATAGTTTTTTTGGGG - Intergenic
1159872200 18:73771081-73771103 TTTTTGATATTGTTTTTTGGAGG - Intergenic
1164072313 19:21779556-21779578 TTTTATCTTTAGATTTTTAGTGG + Intergenic
1164482305 19:28621621-28621643 TTTTAGGTCTCTCTTTTTGGTGG - Intergenic
1167651691 19:50734221-50734243 TTTTTGTTTTTGCTTTTTGGAGG + Intergenic
925353186 2:3217344-3217366 TTTTAGCTAGAGCTTACTGCGGG - Intronic
927092944 2:19726493-19726515 ATTCAGCCATTGCTTTTTGGAGG - Intergenic
929719399 2:44352084-44352106 TTTGAGCAATAGCTTTAAGGAGG - Intronic
930758777 2:55007871-55007893 TCTCAACTATAGCTTTTTAGTGG + Intronic
930825268 2:55690906-55690928 TTTCAGCTATAGGTTGTTGCAGG - Intronic
932776823 2:74533220-74533242 CTTTACCTCTAGCCTTTTGGTGG - Exonic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
935133439 2:100278471-100278493 TTTTGGTTCTTGCTTTTTGGTGG - Exonic
936681209 2:114773758-114773780 TTTTAGATCTAGCCTTTTTGTGG - Intronic
937129708 2:119499797-119499819 TTTTAGCTGTAGGTTTTTTTTGG - Intronic
938084793 2:128392239-128392261 TTTTAAAAATAGCTTTTTTGGGG + Intergenic
938325490 2:130395981-130396003 TTATAACTATATCTTTTTGGTGG - Intergenic
938423475 2:131164216-131164238 TTATAACTATATCTTTTTGGTGG + Intronic
939084488 2:137701485-137701507 TTGTGCCCATAGCTTTTTGGTGG + Intergenic
939603626 2:144225138-144225160 TTCTACCTATACCATTTTGGTGG - Intronic
940450922 2:153835920-153835942 TTTTAGCTTTGCCATTTTGGGGG + Intergenic
940628481 2:156207679-156207701 GTTTAGCTATAGTTTGTTGTTGG - Intergenic
940892377 2:159047439-159047461 TTTTAGCTTTAGCGATTTGGGGG - Intronic
941135280 2:161709045-161709067 TGTTTACTTTAGCTTTTTGGGGG + Intronic
941988318 2:171529864-171529886 ATTTAGACATACCTTTTTGGGGG - Intronic
944233580 2:197421147-197421169 TTTTGTTTATGGCTTTTTGGGGG - Intronic
944771575 2:202919538-202919560 TTAGAGCTCTAGCTTTTGGGTGG + Intronic
945464513 2:210152200-210152222 TTGTATATATAGCATTTTGGGGG - Intronic
946448070 2:219756701-219756723 TTCTAGTTATTGCTTTTAGGAGG - Intergenic
946764801 2:223030679-223030701 TTTTATCATTACCTTTTTGGAGG + Intergenic
947021569 2:225683181-225683203 TTTCAGCAAAAACTTTTTGGTGG + Intergenic
948166408 2:235866161-235866183 TTTTGGTTTTAGATTTTTGGTGG + Intronic
948177029 2:235951877-235951899 TCTTAGCTACAGATTTTTGGTGG + Intronic
1168952529 20:1812190-1812212 TTCTAGCTATTGCCTTTGGGTGG + Intergenic
1169017309 20:2302426-2302448 TCTAAGCTATTGTTTTTTGGGGG - Intronic
1170879472 20:20283197-20283219 TTTTTGCTTTATCTTTTTGGGGG + Intronic
1173689742 20:44951176-44951198 TGTGAGCTAGAGTTTTTTGGGGG + Intronic
1173922547 20:46757246-46757268 TTTTTGCTATTGTTTTTTGTAGG + Intergenic
1176886070 21:14257001-14257023 TTATTTCTATAGGTTTTTGGGGG + Intergenic
1179194021 21:39148640-39148662 TGTTACCCATAGCTTTTTGGTGG + Intergenic
1182160737 22:28118766-28118788 TTTAAGCCAGAGCTTCTTGGTGG - Intronic
1183847814 22:40557306-40557328 GTTTAGCTATAGTATTTTAGTGG - Intronic
949393078 3:3584452-3584474 TTATAGCTATTGTTTTTTGAGGG - Intergenic
953361069 3:42297350-42297372 TTTTACCTATTACCTTTTGGAGG - Intergenic
955780623 3:62480419-62480441 TTTCAGATATAAATTTTTGGAGG + Intronic
957312504 3:78539136-78539158 TTATTTCTATAGGTTTTTGGGGG - Intergenic
959508944 3:107188234-107188256 TGTTAGCTGTAGGTTTTTTGTGG - Intergenic
959741225 3:109722312-109722334 TTTTAGGTTTATCTTTTTAGAGG + Intergenic
959896002 3:111606882-111606904 TCTTAGCTATGACTTTTTTGGGG + Intronic
960262523 3:115583954-115583976 TTTTAATAATAGCTTCTTGGAGG - Intergenic
960285648 3:115825550-115825572 ATTTAGGTTTAGCTTTCTGGAGG - Intronic
960888866 3:122424813-122424835 TTTTAGCTTTGACTTTTTTGTGG - Exonic
961248396 3:125477513-125477535 TTTTTTCTAGAGCTTTTTGTAGG - Intronic
962038515 3:131680681-131680703 TTATTTCTATAGGTTTTTGGGGG + Intronic
964038884 3:152234413-152234435 CTATAGATATAGTTTTTTGGTGG - Intergenic
965940440 3:174173190-174173212 TATCAGCTCTAGTTTTTTGGTGG + Intronic
966380900 3:179344308-179344330 TTTTAACTATTGATTTTTGTTGG + Intergenic
966564849 3:181365353-181365375 TTTTAGGTATAATTTTTTAGAGG - Intergenic
971192118 4:24437637-24437659 TTTTAGTTTTGGTTTTTTGGGGG + Intergenic
971450560 4:26796988-26797010 TTTTAAAAATAGCTTTTTTGAGG - Intergenic
971790301 4:31161923-31161945 TTTTAGATACAGGTTTTTGGAGG + Intergenic
974511176 4:62843478-62843500 TTTTAGTTATAGGTTAGTGGGGG - Intergenic
974912670 4:68142139-68142161 TTTTAACTATAGCTTTCATGAGG - Intergenic
975082470 4:70297584-70297606 TTTTGGCTAATGTTTTTTGGGGG - Intergenic
976662585 4:87555175-87555197 TTTTATCTCTAACTTTTTGAGGG + Intergenic
977517839 4:98044664-98044686 TTTTAGCTTTGAGTTTTTGGGGG + Intronic
979206665 4:118046408-118046430 CTGTGGCTAGAGCTTTTTGGAGG - Intronic
979653752 4:123167266-123167288 CTATATATATAGCTTTTTGGGGG + Intronic
979937740 4:126718834-126718856 ATCTAGCTCTAGCTTTTCGGAGG + Intergenic
980094824 4:128478687-128478709 TTTAAGCCATAGAGTTTTGGGGG + Intergenic
981452305 4:144912344-144912366 TTTTAGCTTTAACTTTTCTGTGG - Intergenic
981760610 4:148191161-148191183 TTTTAGTGATAGCTTGGTGGTGG + Intronic
982575848 4:157109256-157109278 CTTTAGTTTTATCTTTTTGGGGG + Intronic
982884490 4:160761486-160761508 GTTTAGATATAGCTTTTTTTGGG - Intergenic
983350558 4:166582465-166582487 TTTTTTCCATAGGTTTTTGGGGG + Intergenic
983634377 4:169882606-169882628 TTTTGCCTATTTCTTTTTGGGGG + Intergenic
984412696 4:179415031-179415053 TTTTAAATATAGCTTTTTGGGGG - Intergenic
984772237 4:183445538-183445560 TTTTATCCATAACTTTTTGAGGG - Exonic
985329303 4:188810827-188810849 TGTTAGCTATACCTTTTTCATGG - Intergenic
985830810 5:2227995-2228017 TTCTAGCTAAAGCTTTGTGTGGG - Intergenic
987309050 5:16665222-16665244 TTTTTGTTTTGGCTTTTTGGTGG - Intronic
987882594 5:23768749-23768771 TTTTAGCTATAACTATGTAGTGG + Intergenic
988329736 5:29820008-29820030 TTTCAGCAATAGTTTTTTGGCGG - Intergenic
988603866 5:32663916-32663938 TTTTACCCATCTCTTTTTGGTGG + Intergenic
990359426 5:55003457-55003479 TTTTAGAAATAACTTTTTGGGGG - Intronic
991710099 5:69400528-69400550 TTATAGCAATATCTTTTTGTGGG + Intronic
992500646 5:77339384-77339406 TTTCAGCTGTTGCTTTTTGGTGG + Intronic
993196894 5:84760568-84760590 TTCTAGCTCTAGTTTTTTGAGGG + Intergenic
993449737 5:88059148-88059170 TTTTATCAATACTTTTTTGGGGG - Intergenic
993776661 5:92008359-92008381 TTTTAGCTGTAGTTTTTGGTGGG - Intergenic
995346644 5:111127939-111127961 TTTTGGCTACACTTTTTTGGGGG + Exonic
996646287 5:125821935-125821957 TTTTAGATTTCGCTTTTTTGTGG - Intergenic
996758768 5:126965507-126965529 TTTTAGCTATTAGTATTTGGGGG + Intronic
996957132 5:129196936-129196958 TTTTATCAGTAGCTTTGTGGAGG + Intergenic
998713616 5:144854318-144854340 TTTTAGCTATAGAATTTGGTAGG + Intergenic
999469965 5:151845539-151845561 TTTTAACTATAGCCATTTAGTGG - Intronic
1004830123 6:19467627-19467649 TTTTAGGTAAAGCTTTGTGTGGG - Intergenic
1005271665 6:24171578-24171600 TTTTTCCTATATGTTTTTGGGGG - Intergenic
1008743232 6:54635880-54635902 TTTTAGGTATTATTTTTTGGGGG - Intergenic
1009667318 6:66701099-66701121 TTTTAATTATAGTTTATTGGGGG + Intergenic
1009719082 6:67441226-67441248 TTCTACTTATATCTTTTTGGGGG - Intergenic
1011378241 6:86714252-86714274 TTCTATTTTTAGCTTTTTGGGGG - Intergenic
1013349698 6:109294110-109294132 TTTTAGCCAGAGCTGTGTGGGGG - Intergenic
1013380305 6:109562630-109562652 TTTTGGCTCTTGCTTTTTGATGG + Intronic
1014821531 6:125993766-125993788 TCTTTGCTTTTGCTTTTTGGAGG + Exonic
1015560225 6:134506627-134506649 TCTGATCTATAGCTTTTGGGGGG - Intergenic
1015894220 6:138000684-138000706 TCTTAGGTATAGCTTTATAGTGG + Intergenic
1016787873 6:148032820-148032842 TTTTAGCTGTAGGTTTTTTGTGG - Intergenic
1017363827 6:153608911-153608933 TTTTAGATGTAGGTTTTTTGTGG - Intergenic
1017495104 6:154976825-154976847 TTTTAGTTTTAGCCATTTGGAGG + Intronic
1017569891 6:155732532-155732554 TTTTAGAAATAGCTTTTTCAAGG + Intergenic
1017609413 6:156168627-156168649 TCTTTGCTTTTGCTTTTTGGGGG - Intergenic
1017997968 6:159549988-159550010 TTCTAGCTTTAGTTTTTTTGAGG + Intergenic
1018410668 6:163543593-163543615 GTTTACTTAAAGCTTTTTGGCGG + Intronic
1018781801 6:167075083-167075105 TGTTAGCTGTAGGTTTTTTGTGG - Intergenic
1019097156 6:169591597-169591619 TTTTAGCTATAGCTTTTTGGGGG + Intronic
1019222510 6:170485164-170485186 TTTTAGCACAAGTTTTTTGGAGG + Intergenic
1020396136 7:7720834-7720856 TCTTAAATATACCTTTTTGGGGG - Intronic
1021268545 7:18555512-18555534 TTGTAGCTATATTATTTTGGGGG - Intronic
1021274083 7:18627452-18627474 TATTATCTATAACTTTTTGGAGG + Intronic
1021346383 7:19533839-19533861 TTTTGGCTATATGTTTTTTGGGG - Intergenic
1022066951 7:26868394-26868416 TTTTAGCAATAAAGTTTTGGGGG + Intronic
1022429730 7:30304791-30304813 ATTTTCCTATAACTTTTTGGTGG - Intronic
1022998567 7:35784251-35784273 TTATTTCCATAGCTTTTTGGGGG - Intergenic
1023474944 7:40567008-40567030 TTTTAGATGTGGCTTTTGGGGGG - Intronic
1024438395 7:49386654-49386676 TGTTAGCTGTAGGTTTTTGTAGG + Intergenic
1024455602 7:49603314-49603336 TGTTAGCTGTATATTTTTGGAGG + Intergenic
1027562134 7:79743799-79743821 TTTCTGCTTTATCTTTTTGGTGG + Intergenic
1027844367 7:83353467-83353489 TTTTTCATATAGCTTTTTGTTGG + Intergenic
1028719932 7:94017869-94017891 TTTTAAATATAGCTTTATGATGG + Intergenic
1030827900 7:114184437-114184459 TTTTAGCTATAGGACATTGGGGG + Intronic
1031605023 7:123758244-123758266 TTGTAAATAGAGCTTTTTGGGGG + Intergenic
1031848784 7:126838230-126838252 TTTTAGAAATAGCATCTTGGGGG + Intronic
1032319391 7:130872241-130872263 TTTTAGATAAACTTTTTTGGGGG - Intergenic
1033678057 7:143563889-143563911 TTTTAGCAATATTTTTGTGGGGG - Intergenic
1033693782 7:143765555-143765577 TTTTAGCAATATTTTTGTGGGGG + Intergenic
1034249820 7:149680014-149680036 TTGTATCTGTAGATTTTTGGGGG + Intergenic
1035134471 7:156687637-156687659 TTTTAGTTAAAGCTTTTTTGAGG - Intronic
1036203395 8:6787619-6787641 TATTAGCTCTGGGTTTTTGGTGG - Intergenic
1038268318 8:26053144-26053166 TTTTATTTATAATTTTTTGGTGG + Intergenic
1038362013 8:26889703-26889725 TTTTAGTTCTAGAATTTTGGGGG + Intergenic
1039198069 8:35054563-35054585 TTTCAGCTACAGAATTTTGGAGG + Intergenic
1039597432 8:38803151-38803173 TTTCATTTATAGTTTTTTGGTGG + Intronic
1040611464 8:48987484-48987506 TGTTAGCTGTAGGTTTTTGTAGG + Intergenic
1040695304 8:49989970-49989992 TGTTAGCTATAGGTTTTTCATGG - Intronic
1041172997 8:55164306-55164328 TGTCAGCTATTGCTATTTGGAGG + Exonic
1041465601 8:58154960-58154982 TACAAGCTCTAGCTTTTTGGAGG + Intronic
1041679385 8:60572774-60572796 TATAAGCTAAAGCTCTTTGGGGG - Intronic
1042192862 8:66205639-66205661 TTTTGGCTGTAGATTTGTGGGGG + Intergenic
1042421395 8:68594050-68594072 TTTTAGTTATACTTTTTTGGGGG + Intronic
1043156308 8:76785407-76785429 TTTTAGCTGCAGATTTTTGCAGG + Intronic
1044433495 8:92135687-92135709 TTTTATTTATTTCTTTTTGGTGG + Intergenic
1044835514 8:96291958-96291980 TTATAGGTATGACTTTTTGGAGG + Intronic
1045694007 8:104787536-104787558 TTTTAAATATGGCTATTTGGAGG - Intronic
1046159984 8:110349233-110349255 CTTTGGCTCTAGCTATTTGGAGG - Intergenic
1046334749 8:112771019-112771041 TTTTATTTATAGATTTTTAGAGG - Intronic
1047068362 8:121313600-121313622 TTTTAACTTTATCATTTTGGTGG + Intergenic
1048154202 8:131927646-131927668 TTTTAGCAAGAGCTTTTTTTAGG + Intronic
1048298122 8:133230469-133230491 TTTGAGCTCTAACTTTTTGGGGG - Intergenic
1048616597 8:136081787-136081809 TTTTAGATAAAGCTTTTATGTGG - Intergenic
1048672933 8:136743475-136743497 TTTTTGTTTTTGCTTTTTGGGGG - Intergenic
1050175803 9:2868327-2868349 TGTTAGACATAGCTTTTTGGGGG + Intergenic
1050471643 9:5998049-5998071 TTTTGGCTAGAGCAATTTGGTGG + Intronic
1051203343 9:14656075-14656097 ATTTCGTTATACCTTTTTGGTGG - Intronic
1051703415 9:19850450-19850472 TTTTATTTATAGCTTTATTGAGG + Intergenic
1052041327 9:23742173-23742195 TCTTGGGTTTAGCTTTTTGGTGG - Intronic
1052379797 9:27757739-27757761 TTTTGGCTATCCCTTTTTTGGGG + Intergenic
1057091955 9:92266290-92266312 ATTTAGCTCTAGCTTTTTCTTGG - Intronic
1057272845 9:93660412-93660434 TTTGAGCTTCAGCGTTTTGGGGG - Exonic
1058828948 9:108798395-108798417 TTTTATCCATCCCTTTTTGGTGG - Intergenic
1058981319 9:110173387-110173409 TTTTTGCTAGAGCTTTATTGTGG + Intergenic
1059815915 9:117914912-117914934 TTTTGGTTATAGCTTGTTGGTGG + Intergenic
1186641385 X:11459556-11459578 GTTTAGCTATTGTTTTGTGGTGG + Intronic
1186889178 X:13943355-13943377 TATTAACTATAGTCTTTTGGGGG + Intergenic
1189229147 X:39438578-39438600 TTTTACCTTTGGCTTTTTGGGGG - Intergenic
1189607141 X:42691414-42691436 TTATAGAGATAGCTTCTTGGAGG - Intergenic
1193063904 X:77236601-77236623 TTTTATCTATAGCTGTTTTTAGG - Intergenic
1193239152 X:79145592-79145614 TCTTTGCTATAACTCTTTGGGGG + Intergenic
1195033800 X:100952322-100952344 TGTTAGCTCTAGTTTTTTGGTGG - Intergenic
1195092579 X:101475414-101475436 TTTTACCTATAGTGGTTTGGAGG - Intronic
1195545905 X:106112397-106112419 TTTTATCTATATCTTTATGTAGG + Intergenic
1197047952 X:122022922-122022944 TTGAATCTATAGATTTTTGGGGG + Intergenic
1197732851 X:129826774-129826796 TGTGAGCTATAACTATTTGGGGG - Intronic
1198089020 X:133309225-133309247 TTTAAGTGATAACTTTTTGGAGG - Intronic
1201618423 Y:15927754-15927776 TTTAAGCTAGAGTTTTCTGGTGG + Intergenic