ID: 1019098759

View in Genome Browser
Species Human (GRCh38)
Location 6:169610087-169610109
Sequence CAAAATGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 38, 1: 78, 2: 68, 3: 54, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019098759 Original CRISPR CAAAATGCTGATAGTGATAT GGG (reversed) Intronic