ID: 1019099703

View in Genome Browser
Species Human (GRCh38)
Location 6:169619470-169619492
Sequence CACTTTGGGCACATGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2774
Summary {0: 1, 1: 50, 2: 517, 3: 853, 4: 1353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019099703_1019099709 9 Left 1019099703 6:169619470-169619492 CCTCAGAACATGTGCCCAAAGTG 0: 1
1: 50
2: 517
3: 853
4: 1353
Right 1019099709 6:169619502-169619524 AGCTTGGTTTTATACATTTTAGG 0: 623
1: 1344
2: 1234
3: 774
4: 777
1019099703_1019099708 -7 Left 1019099703 6:169619470-169619492 CCTCAGAACATGTGCCCAAAGTG 0: 1
1: 50
2: 517
3: 853
4: 1353
Right 1019099708 6:169619486-169619508 CAAAGTGGTCAGGTGCAGCTTGG 0: 1
1: 1
2: 3
3: 27
4: 216
1019099703_1019099710 10 Left 1019099703 6:169619470-169619492 CCTCAGAACATGTGCCCAAAGTG 0: 1
1: 50
2: 517
3: 853
4: 1353
Right 1019099710 6:169619503-169619525 GCTTGGTTTTATACATTTTAGGG 0: 626
1: 1297
2: 1177
3: 801
4: 1103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019099703 Original CRISPR CACTTTGGGCACATGTTCTG AGG (reversed) Intronic
Too many off-targets to display for this crispr