ID: 1019102514

View in Genome Browser
Species Human (GRCh38)
Location 6:169642654-169642676
Sequence TCTAGCAGGCCCCCAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 180}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019102514_1019102528 17 Left 1019102514 6:169642654-169642676 CCTGCCCTTGGGGGCCTGCTAGA 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1019102528 6:169642694-169642716 GCAAGCAGAGGGTGTGAGGCGGG No data
1019102514_1019102523 5 Left 1019102514 6:169642654-169642676 CCTGCCCTTGGGGGCCTGCTAGA 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1019102523 6:169642682-169642704 CCCTGGGTGTTAGCAAGCAGAGG No data
1019102514_1019102526 13 Left 1019102514 6:169642654-169642676 CCTGCCCTTGGGGGCCTGCTAGA 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1019102526 6:169642690-169642712 GTTAGCAAGCAGAGGGTGTGAGG No data
1019102514_1019102530 27 Left 1019102514 6:169642654-169642676 CCTGCCCTTGGGGGCCTGCTAGA 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1019102530 6:169642704-169642726 GGTGTGAGGCGGGAGTCACTGGG 0: 1
1: 0
2: 0
3: 9
4: 157
1019102514_1019102531 28 Left 1019102514 6:169642654-169642676 CCTGCCCTTGGGGGCCTGCTAGA 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1019102531 6:169642705-169642727 GTGTGAGGCGGGAGTCACTGGGG 0: 1
1: 0
2: 1
3: 16
4: 201
1019102514_1019102529 26 Left 1019102514 6:169642654-169642676 CCTGCCCTTGGGGGCCTGCTAGA 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1019102529 6:169642703-169642725 GGGTGTGAGGCGGGAGTCACTGG No data
1019102514_1019102532 29 Left 1019102514 6:169642654-169642676 CCTGCCCTTGGGGGCCTGCTAGA 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1019102532 6:169642706-169642728 TGTGAGGCGGGAGTCACTGGGGG 0: 1
1: 0
2: 2
3: 18
4: 210
1019102514_1019102525 6 Left 1019102514 6:169642654-169642676 CCTGCCCTTGGGGGCCTGCTAGA 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1019102525 6:169642683-169642705 CCTGGGTGTTAGCAAGCAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 144
1019102514_1019102527 16 Left 1019102514 6:169642654-169642676 CCTGCCCTTGGGGGCCTGCTAGA 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1019102527 6:169642693-169642715 AGCAAGCAGAGGGTGTGAGGCGG 0: 1
1: 0
2: 5
3: 57
4: 608

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019102514 Original CRISPR TCTAGCAGGCCCCCAAGGGC AGG (reversed) Intronic
900285199 1:1895723-1895745 TCTCAGAGGCCCCCAAGGCCCGG - Intergenic
903834917 1:26197626-26197648 CCTAGGATGCCCCCATGGGCTGG + Intronic
904379071 1:30099168-30099190 TGTAGCAGGCGGCCCAGGGCAGG + Intergenic
914827617 1:151146726-151146748 TCTAGCCGCCCTCCGAGGGCGGG - Intergenic
917772383 1:178293862-178293884 TCTATCAGTCCCCTAAGGGAAGG - Intronic
919782662 1:201230897-201230919 TGTCCCAGGCCTCCAAGGGCAGG - Intergenic
919992473 1:202718052-202718074 CCCAGCAGGCCCCTGAGGGCAGG + Intergenic
920335054 1:205239445-205239467 TCAAGCTGGCCCCCAGGGGATGG + Intronic
922170679 1:223151824-223151846 TCTAGCAGGCTCTCAAGCTCAGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923222972 1:231913245-231913267 TCTAGCTTGCCCCCAGTGGCTGG + Intronic
923519763 1:234726399-234726421 TCTAGAAGGTCACCAGGGGCTGG - Intergenic
924289190 1:242520797-242520819 TCTTGCAGCCTCCCTAGGGCTGG - Intronic
924684034 1:246268888-246268910 TGTTGCAGGACCCCAAGGGAGGG - Intronic
1067278621 10:44855023-44855045 TCCTGCAGGCCCCCATGGGTGGG - Intergenic
1068010242 10:51439706-51439728 TCTTCGAGGCCCTCAAGGGCAGG + Intronic
1069592785 10:69652373-69652395 TCTGGGAGGCTCCCAGGGGCAGG - Intergenic
1069949755 10:72010741-72010763 TCTGGCAGGCCCAGAAGTGCTGG + Exonic
1070570819 10:77638285-77638307 GCTAGCAGGCGGCCACGGGCCGG - Intronic
1071317685 10:84418568-84418590 TCTCACAGGCCTCCATGGGCTGG + Intronic
1071563464 10:86659901-86659923 CCTTGCAGGCCCCGAAGGTCTGG - Exonic
1072189463 10:93068321-93068343 GCTACCAGATCCCCAAGGGCTGG + Exonic
1075394006 10:122113602-122113624 GCGCGGAGGCCCCCAAGGGCGGG - Intronic
1076393621 10:130121990-130122012 TCCTAGAGGCCCCCAAGGGCTGG - Intergenic
1076571812 10:131438162-131438184 TCCATCAGGCCCCACAGGGCAGG - Intergenic
1077370565 11:2179829-2179851 TCTTGCAGGCCCCCAAAGTCAGG - Intergenic
1077423997 11:2466003-2466025 TCATGCAGGCCCTGAAGGGCGGG - Intronic
1077508652 11:2943797-2943819 TGCAGCATACCCCCAAGGGCCGG - Intergenic
1078455462 11:11471215-11471237 TGCAGCAGTTCCCCAAGGGCAGG + Intronic
1081566115 11:44262295-44262317 GTTAGGTGGCCCCCAAGGGCTGG + Exonic
1081690331 11:45073779-45073801 TCTGGCAGGGCCCTAAGGGAGGG + Intergenic
1081694300 11:45098857-45098879 GCTAGAAGACCCCCAAGGGTGGG + Intronic
1084973999 11:72786549-72786571 TCCAGCAGCTCCCTAAGGGCAGG - Intronic
1084980415 11:72825850-72825872 TCTAGGAAGCCCCCAGGAGCCGG - Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1091797090 12:3303709-3303731 TCCAGGAGCCCCCAAAGGGCTGG - Intergenic
1091937413 12:4444915-4444937 TCTGGGAAGCCCCCAAGGCCTGG - Intronic
1094653445 12:32399456-32399478 GCCAGCAGGTCCCCAAGGGCGGG - Intergenic
1095234333 12:39778365-39778387 TACAGCTGGCCCCCAAGAGCTGG - Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1096517665 12:52166018-52166040 TCAAGCAGGCACCCAAGAGGTGG - Intergenic
1097287088 12:57886765-57886787 TGTAGCAGGCACCTAAGGGCAGG + Intergenic
1098131177 12:67351974-67351996 ACTACCAGCCCCCCAAAGGCAGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1100281297 12:93120677-93120699 TGTAGCAGGTACCCAAAGGCTGG - Intergenic
1103477441 12:121229189-121229211 TCAGGCAGCACCCCAAGGGCAGG + Intronic
1105891825 13:24687614-24687636 GATGGCAGGCCCCCCAGGGCAGG + Intronic
1107958871 13:45542018-45542040 TCTTGCAGGGCCCCATGGTCGGG - Intronic
1111611417 13:90612949-90612971 TCTAGCTGACTCCCAAGGGTGGG + Intergenic
1112495461 13:99900477-99900499 TCTTGCAGACCCTTAAGGGCTGG + Intergenic
1113768846 13:112895974-112895996 TCTGTCAGGCCCCCAGGGGAGGG - Intronic
1115975080 14:38988525-38988547 TCTAGCAGTTCCTCAAGGTCAGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1120868964 14:89320189-89320211 TCTTGCAGCCTCCCAAGGGTGGG + Intronic
1121417624 14:93789687-93789709 TCCAGAAGGCCCTCAAGGCCTGG + Intergenic
1122417730 14:101558309-101558331 CCTGCCAGGCCCCCGAGGGCCGG + Intergenic
1122988065 14:105221725-105221747 TCCAGCAGGGACCCCAGGGCCGG + Exonic
1123072948 14:105651083-105651105 TCCAGCAGGGTCACAAGGGCAGG - Intergenic
1123092872 14:105749852-105749874 TCCAGCAGGGTCACAAGGGCAGG - Intergenic
1123783573 15:23647474-23647496 ACTATCGGGCCCCCTAGGGCAGG + Exonic
1124219147 15:27834340-27834362 TCTGGCAGGGTCCCAAGTGCAGG - Intronic
1124400252 15:29341701-29341723 TATAGAAGGCCCCCAAGACCCGG - Intronic
1124860085 15:33430860-33430882 TCTGGCAGGCCCCCAAGAGTGGG + Intronic
1128806106 15:70532443-70532465 TCTGGAGGGTCCCCAAGGGCAGG - Intergenic
1129850139 15:78789123-78789145 TCTAGCAAGCCATCAAAGGCAGG - Intronic
1129969684 15:79767328-79767350 TGTAGCAGGCACTCAAGTGCTGG + Intergenic
1130963685 15:88681852-88681874 TGTGGCCGGCCCCCGAGGGCGGG + Intergenic
1131511263 15:93050787-93050809 TCCTGCAGGTTCCCAAGGGCTGG - Intronic
1132864815 16:2088100-2088122 TCTGGCGGGCCACGAAGGGCAGG - Exonic
1133028975 16:3000754-3000776 TCAAGCCGGCCCCCCAGGCCTGG - Intergenic
1133578231 16:7115776-7115798 TCTAGCCTGCCCCGAAGGGGAGG + Intronic
1137271957 16:46907973-46907995 TCTACCAGTCCCCCAAGCCCAGG - Intronic
1137271977 16:46908037-46908059 TCTACCAGTCCCCCAAGCCCAGG - Intronic
1137856293 16:51797563-51797585 TTAAGCAGGCCCCCATAGGCAGG - Intergenic
1142856649 17:2734325-2734347 TCAAGCAGGACCTCATGGGCAGG - Intergenic
1143078607 17:4365879-4365901 TCCAGCCGGCCCCGAAGGTCCGG + Intronic
1143461513 17:7107252-7107274 TCTGGCAGGCCACGAAGCGCAGG + Exonic
1143877118 17:10000319-10000341 TCTAGAAGGCAACAAAGGGCAGG + Intronic
1145960844 17:28885789-28885811 TCTGCCAGGCCCCGCAGGGCAGG + Intronic
1147057671 17:37846740-37846762 TCTGGCAGGCCCCCAACAGAGGG - Intergenic
1148519077 17:48252159-48252181 TCTAACAGCCCCCAAAGGGTTGG + Intronic
1148866845 17:50633243-50633265 TCTGAGAGGTCCCCAAGGGCAGG - Intergenic
1150684645 17:67310693-67310715 TCTAATAGACACCCAAGGGCTGG - Intergenic
1152307655 17:79530678-79530700 TATTGCAGGCACCCGAGGGCTGG - Intergenic
1159320309 18:66839217-66839239 CCTATGAGTCCCCCAAGGGCAGG - Intergenic
1159885020 18:73895596-73895618 TCTAGCAGCTTCCCAAGGGTAGG + Intergenic
1162490903 19:10990983-10991005 TCTAGCAGGTGCCCCCGGGCAGG - Intronic
1165060096 19:33200995-33201017 CCTAGTAGGCCCCCAGGGGAAGG + Intronic
1165242695 19:34481130-34481152 TCGCCCAGGCCCCCAAGGCCAGG - Intergenic
1165454994 19:35905334-35905356 TCTATGTGGCCCCCAGGGGCAGG + Intronic
1165467505 19:35983730-35983752 GTTACCAGGACCCCAAGGGCTGG - Intergenic
1166581603 19:43905228-43905250 TCTGGGAGGCCCAGAAGGGCAGG - Intergenic
1166833264 19:45651076-45651098 TCTTGCAGGGCCTCAAAGGCTGG + Intergenic
925162700 2:1697042-1697064 TCTAACAGGCTCCCAAGCACTGG - Intronic
925288578 2:2731357-2731379 TCCAGCTGGCTCCCAAGGCCTGG - Intergenic
925342335 2:3146177-3146199 TTCAGCAGGCCCTCAACGGCTGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
930104919 2:47632134-47632156 TCAAGCAGGCCTGCAAGGGCGGG + Intergenic
930191767 2:48466894-48466916 TCTAAAAGGCCCCTAAGGGCAGG + Intronic
932779984 2:74553881-74553903 CCGAGCAGGACCCTAAGGGCTGG + Exonic
937345122 2:121120721-121120743 TCTTGCAGCCCCCCAAGGTGCGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948264395 2:236626580-236626602 TCTGGCAGGCTCCCATAGGCAGG + Intergenic
948863674 2:240764771-240764793 TCAAGGAGGCCCCCAACGGTGGG + Intronic
1173465655 20:43279077-43279099 TGTCCCAGGCCCCCAGGGGCAGG + Intergenic
1174338766 20:49883087-49883109 TCTAGGAGCTCCCCAAGGGTGGG + Intronic
1175371593 20:58496323-58496345 TGTAGCAGCCCCTCATGGGCAGG + Intronic
1178529174 21:33360818-33360840 TCTAGCATGCTCCCTAGGGAAGG + Intergenic
1179144241 21:38753075-38753097 TCTCGGAGGCCCCCATGGGGAGG + Intergenic
1181003068 22:19997085-19997107 TCCAGCATGCCCCCTGGGGCTGG - Intronic
1182494392 22:30695697-30695719 TCTGGCCCGCCGCCAAGGGCCGG + Intronic
1183040874 22:35177043-35177065 ACTAGAAGCCCCCTAAGGGCAGG + Intergenic
1184860672 22:47171672-47171694 GCTGGCAGCCCACCAAGGGCAGG - Intronic
1185166084 22:49263151-49263173 TCTGGGAGGCCTCCAAGGCCTGG + Intergenic
1185380701 22:50506412-50506434 GCAAGGAGGCCCCCCAGGGCAGG - Exonic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
951508685 3:23478249-23478271 TCTAGGAGTCCCCTGAGGGCAGG - Intronic
952794888 3:37230210-37230232 TGTAGCTGAGCCCCAAGGGCAGG - Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953789628 3:45937396-45937418 TCTCTGTGGCCCCCAAGGGCAGG + Intronic
954748544 3:52800778-52800800 TCTGGGAGCCCCTCAAGGGCAGG + Intronic
957389383 3:79543423-79543445 TCTCCCAGGCAACCAAGGGCTGG - Intronic
959117006 3:102190480-102190502 TCCTGCAGGCACCCAGGGGCTGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962967829 3:140370794-140370816 TCCAGCATGCCCCCAACTGCTGG - Intronic
964419535 3:156486679-156486701 TCCAGGAGGCCCTGAAGGGCAGG - Intronic
966887061 3:184382656-184382678 TCTAGAAGGCCCCCCACAGCAGG + Exonic
969325688 4:6442530-6442552 AATAGCATGGCCCCAAGGGCTGG + Intronic
975156917 4:71082424-71082446 TCTAGCAGGCAGGCAAGGGAGGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
985026184 4:185741688-185741710 TCAAGCAGGGCCACAAGAGCAGG - Intronic
985174861 4:187189857-187189879 TCTGACAGTCTCCCAAGGGCTGG - Intergenic
985510171 5:309075-309097 TGTACCAGGCCCCCAAGAGCTGG + Intronic
985673331 5:1217656-1217678 TGTAGGAGGCCTCCAAGTGCAGG + Intronic
986180832 5:5391595-5391617 TCTTGCAGGCCACCAAGAGGAGG - Intergenic
986252104 5:6069521-6069543 TCTAGCAAGCCACCAGAGGCTGG + Intergenic
986822704 5:11484888-11484910 TTTGGCAGGCCCACCAGGGCAGG - Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987297765 5:16569118-16569140 TCTCGCAGGCCTCCTAGCGCAGG - Intronic
987707298 5:21472926-21472948 TCTTGCAGGCCACCAAGAGGAGG + Intergenic
991041651 5:62182514-62182536 CCTCCCAGGCCCCCATGGGCAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997969859 5:138392217-138392239 GGAAGCAGGCCCCCAAGGGCCGG + Exonic
999375708 5:151085378-151085400 TCCAGGAGGACCCCAAGGCCTGG + Intronic
1001005002 5:168042317-168042339 CCGAGCAGGCCCCCAGGAGCAGG - Intronic
1001524427 5:172418581-172418603 TGTTGCAGGCCCGCAAGGGCTGG + Intronic
1001638196 5:173227741-173227763 TCTTGCAGGCCCTCAAGAACTGG + Intergenic
1002597667 5:180334793-180334815 CCTCCCAGGCCTCCAAGGGCAGG - Intronic
1006909008 6:37551866-37551888 TCTACCATACCCCAAAGGGCAGG - Intergenic
1007070767 6:39036741-39036763 TCTTGCAAGCCCCGGAGGGCTGG - Intergenic
1007108069 6:39296901-39296923 CCTGGGAGCCCCCCAAGGGCAGG + Intergenic
1009020924 6:57947570-57947592 TCTTGCAGGCCACCAAGAGGAGG - Intergenic
1010727596 6:79353047-79353069 TCTAGGAGGACCCCAACTGCAGG + Intergenic
1015773764 6:136793152-136793174 TCCACCAGGCCGCCAAGGCCCGG - Intergenic
1018788340 6:167126525-167126547 GCTCACAGGCCCCCCAGGGCTGG - Intronic
1018894356 6:168003085-168003107 TCTAACAGGCCTCCATGGCCAGG + Intronic
1019102514 6:169642654-169642676 TCTAGCAGGCCCCCAAGGGCAGG - Intronic
1019919180 7:4152040-4152062 CCTAGCAGGCAGCCAAGGGTTGG - Intronic
1020838668 7:13186396-13186418 TGTCTCAGGCCCCCAAGCGCTGG - Intergenic
1021401901 7:20219286-20219308 TCTAACAGCTCCCCAAGGACTGG + Intergenic
1022499500 7:30873572-30873594 TCTATCAGGCTCCCCAGGGAGGG + Intronic
1023609065 7:41956149-41956171 TCTTGCAAGCCCTGAAGGGCTGG + Intergenic
1026571588 7:71536232-71536254 TCTAGGAGCCTCCCAAAGGCAGG - Intronic
1028748133 7:94350829-94350851 TCTAGAAGGCCCACTAGGGAGGG + Intergenic
1034291160 7:149932863-149932885 TCTTCCAGGCACCCAAGGTCTGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034814938 7:154164069-154164091 TCTTCCAGGCACCCAAGGTCTGG + Intronic
1035725054 8:1819078-1819100 TCTAGCAGGGCCTAAAGGCCTGG - Intergenic
1038012757 8:23487752-23487774 TGAAGCAGGCCCACATGGGCAGG - Intergenic
1040276915 8:46018524-46018546 GCAAGAAGGCCCCCAAGGGAAGG - Intergenic
1040277557 8:46021767-46021789 GCAAGAAGGCCCCCAAGGGAAGG - Intergenic
1040278201 8:46024595-46024617 GCAAGAAGGCCCCCAAGGGAAGG - Intergenic
1045352251 8:101352601-101352623 TCTAGCAAGCCGGCAAGAGCTGG - Intergenic
1049230440 8:141478850-141478872 TCTAGCAGGGCCCTGGGGGCAGG + Intergenic
1051332157 9:16033866-16033888 GGTGGCAGGGCCCCAAGGGCAGG + Intronic
1052340137 9:27356985-27357007 TCTAGAAGGCTCTCAGGGGCAGG - Intronic
1056193325 9:84205957-84205979 TCCAGCAGACCCCCCAAGGCGGG - Intergenic
1056572014 9:87824744-87824766 TCTGGTAGGCGCCCTAGGGCGGG + Intergenic
1056605552 9:88082081-88082103 TCTAGAAGGGTCCCCAGGGCAGG - Intergenic
1060412987 9:123412158-123412180 TTGAGCAGGCGCCCAAGGACAGG - Intronic
1060591332 9:124818951-124818973 CCCAGCAGGCTCTCAAGGGCAGG - Intergenic
1062430099 9:136523105-136523127 TGTAGGAGGCCTCGAAGGGCAGG + Exonic
1186625018 X:11284126-11284148 TCTAGCAAGCTCCCAGGTGCTGG + Intronic
1194520059 X:94908331-94908353 TCTTGCATGCCCCCAGGGGACGG + Intergenic
1201763903 Y:17562819-17562841 TCAAACAGGCCCCCAGGGGAAGG - Intergenic
1201837650 Y:18343171-18343193 TCAAACAGGCCCCCAGGGGAAGG + Intergenic
1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202293334 Y:23334590-23334612 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202445100 Y:24950249-24950271 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic