ID: 1019103488

View in Genome Browser
Species Human (GRCh38)
Location 6:169650389-169650411
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3048
Summary {0: 1, 1: 1, 2: 31, 3: 319, 4: 2696}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019103488 Original CRISPR ATGAGGGGATGGAGGGATGA CGG (reversed) Intronic
Too many off-targets to display for this crispr