ID: 1019106480

View in Genome Browser
Species Human (GRCh38)
Location 6:169671690-169671712
Sequence TCCGAGATCCTGCTTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019106474_1019106480 1 Left 1019106474 6:169671666-169671688 CCTCACCCTCAGCGCACATGCCC 0: 1
1: 0
2: 2
3: 24
4: 273
Right 1019106480 6:169671690-169671712 TCCGAGATCCTGCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 101
1019106472_1019106480 10 Left 1019106472 6:169671657-169671679 CCTTCTCACCCTCACCCTCAGCG 0: 1
1: 1
2: 1
3: 53
4: 521
Right 1019106480 6:169671690-169671712 TCCGAGATCCTGCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 101
1019106471_1019106480 11 Left 1019106471 6:169671656-169671678 CCCTTCTCACCCTCACCCTCAGC 0: 1
1: 1
2: 4
3: 114
4: 1238
Right 1019106480 6:169671690-169671712 TCCGAGATCCTGCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 101
1019106473_1019106480 2 Left 1019106473 6:169671665-169671687 CCCTCACCCTCAGCGCACATGCC 0: 1
1: 0
2: 1
3: 23
4: 210
Right 1019106480 6:169671690-169671712 TCCGAGATCCTGCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 101
1019106470_1019106480 18 Left 1019106470 6:169671649-169671671 CCTTCATCCCTTCTCACCCTCAC 0: 1
1: 0
2: 2
3: 118
4: 1501
Right 1019106480 6:169671690-169671712 TCCGAGATCCTGCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 101
1019106469_1019106480 26 Left 1019106469 6:169671641-169671663 CCTTGGCACCTTCATCCCTTCTC 0: 1
1: 0
2: 4
3: 29
4: 398
Right 1019106480 6:169671690-169671712 TCCGAGATCCTGCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 101
1019106476_1019106480 -5 Left 1019106476 6:169671672-169671694 CCTCAGCGCACATGCCCCTCCGA 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1019106480 6:169671690-169671712 TCCGAGATCCTGCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 101
1019106475_1019106480 -4 Left 1019106475 6:169671671-169671693 CCCTCAGCGCACATGCCCCTCCG 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1019106480 6:169671690-169671712 TCCGAGATCCTGCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019106480 Original CRISPR TCCGAGATCCTGCTTCTCAA AGG Intronic
900528481 1:3140900-3140922 TCCGACCGCCTGCTTCTCCAGGG - Intronic
902159527 1:14518961-14518983 TCGGAGATCCTGTTGCTCTAGGG + Intergenic
903920280 1:26795131-26795153 TCCAAGATCGGGCTTCTCTAGGG - Exonic
904269346 1:29339247-29339269 TCCCATATCTGGCTTCTCAAAGG - Intergenic
906686271 1:47765419-47765441 TCCCAAATCCAGCTTCACAAAGG + Exonic
908318028 1:62953680-62953702 TCGGAGAAACTGGTTCTCAAGGG + Intergenic
909406495 1:75296273-75296295 TTGCAGATCCTACTTCTCAATGG + Intronic
915739539 1:158108137-158108159 TCCCAGATCCTCCTTTTAAAAGG + Intergenic
917098747 1:171425422-171425444 CCCGAGAAGCTGCTTCTCCATGG - Intergenic
924700169 1:246443435-246443457 TCTGAGAGGCTGCTTCTTAATGG - Intronic
1063402474 10:5759755-5759777 TCTGAGATTCTGTTCCTCAAAGG - Intronic
1071200693 10:83218609-83218631 TCCAAGATTCTGCCTCCCAAAGG - Intergenic
1074191177 10:111139152-111139174 GCCGACATCCTTCTTCTCAATGG + Intergenic
1076093173 10:127707042-127707064 TCAGAGCTCCTGTTTCTGAAAGG - Intergenic
1076741562 10:132488266-132488288 TCCCAGCTCCTGCTGCTCCAGGG - Intergenic
1082717539 11:56633304-56633326 TCCCAGCTCCAGCTACTCAATGG - Intergenic
1084546547 11:69817821-69817843 TCCGCTATCCTGCTCCTCAAAGG + Intronic
1085941581 11:81211960-81211982 TCCCATCTCCTGCATCTCAAGGG - Intergenic
1089352115 11:117827717-117827739 TCTGAGTTCCTGCATCTCTAAGG + Intronic
1090872740 11:130762590-130762612 CCCCAGATCCTTCTTCTCCAGGG + Intergenic
1091311923 11:134580786-134580808 TCCAAGTTGGTGCTTCTCAAGGG + Intergenic
1091594054 12:1863947-1863969 TCCGAAACTCTGCTGCTCAAGGG - Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1094117971 12:26938181-26938203 GCCCAGATCCTGCTTCCCAATGG - Exonic
1098415035 12:70223717-70223739 TCAGCGATCCAGTTTCTCAAGGG + Intergenic
1098497989 12:71158845-71158867 TTCCACATCCTGCCTCTCAAAGG + Intronic
1098514219 12:71355054-71355076 TCCGACAGACTGATTCTCAAGGG + Intronic
1100411417 12:94322925-94322947 TCCCAGACCCTGCTTTTCAATGG - Intronic
1101554080 12:105790820-105790842 TCTGAGAACATGCTTCTCCACGG - Intergenic
1102559231 12:113750218-113750240 TTCGAGTTCCTGGTTCTCATTGG + Intergenic
1106131796 13:26946896-26946918 TCCCAGACCCTGCTGCTCAGAGG - Intergenic
1112427229 13:99313615-99313637 TCTGAAACCCTGCTTCTCAGTGG - Intronic
1113173920 13:107538635-107538657 TCATAGATCCTGTTTCTCATTGG + Intronic
1117175824 14:53145555-53145577 TCCCATATCATGTTTCTCAAAGG + Intronic
1118256346 14:64209229-64209251 TCAGAGCTCCTGCTTCACAGAGG - Intronic
1118602999 14:67483450-67483472 TCTGAGTTCCTGCTTCTGGAAGG + Intronic
1119369144 14:74123446-74123468 TCCCAAATCTTTCTTCTCAAAGG - Intronic
1119535688 14:75400877-75400899 ACTGAGATCCTTCTTCTGAAAGG - Intergenic
1122309044 14:100783190-100783212 TCCCCGATCCTGCCTCTCACGGG - Intergenic
1126161882 15:45621206-45621228 TTGGAGGTCCTGATTCTCAAAGG + Intronic
1129178347 15:73856054-73856076 TCCGAGGTCCTTCCCCTCAATGG + Intergenic
1130179399 15:81609847-81609869 TCCTGTATCCTGTTTCTCAATGG - Intergenic
1130634365 15:85603073-85603095 TCTTAGAACCTGCTTCTCAAGGG - Intronic
1131439246 15:92446454-92446476 ACATAGATCCTGCCTCTCAATGG + Intronic
1132839604 16:1972579-1972601 TCCGCGATCCGTCTTCTCCAGGG + Intronic
1135166237 16:20141562-20141584 TCCCAGGTCCTGCAGCTCAAGGG + Intergenic
1137706517 16:50539399-50539421 TCCTACAGCCTGCCTCTCAATGG + Intergenic
1141919789 16:87128038-87128060 TCCCAGCCTCTGCTTCTCAAGGG + Intronic
1142114187 16:88347906-88347928 TCTGAGATCCTCCTCCTCAGGGG - Intergenic
1144014220 17:11178522-11178544 TCAGAGATTCTCCTTCCCAAGGG - Intergenic
1144236562 17:13266809-13266831 GCCAAGATCCTGCTCCTCGAGGG - Intergenic
1149779102 17:59382186-59382208 TCATAGATACTGCTCCTCAAGGG + Intronic
1153490553 18:5643216-5643238 TCTTAGATCCTGTTTCTCGAGGG + Intergenic
1155847184 18:30722835-30722857 TCCAATATCCTGCTTTTCAAGGG - Intergenic
1156249935 18:35343671-35343693 TCCAAGACCCTGCTTATCAACGG + Intronic
1156982522 18:43307230-43307252 TCCAAATTCCTGCTTCTCCATGG - Intergenic
1161770500 19:6228387-6228409 TCCCAGTTCCTTTTTCTCAACGG - Intronic
1162492147 19:10999295-10999317 TCCCAGATCCGGCTGCTCAGAGG - Intronic
926298765 2:11587545-11587567 TCAAAGACACTGCTTCTCAAGGG - Intronic
927329658 2:21847351-21847373 TCCAATATCCTGCATCTCTAAGG + Intergenic
937046948 2:118856936-118856958 TCCGAGTTCGTGCGGCTCAAGGG + Intergenic
940104906 2:150088813-150088835 CCCATGCTCCTGCTTCTCAAAGG - Intergenic
941239618 2:163019804-163019826 TCCAAGAACCTGCTTTTCCAAGG + Intergenic
941677309 2:168357364-168357386 TCCCAGAGTCTGCTGCTCAATGG - Intergenic
947093251 2:226537453-226537475 TCAGAGGCCCTACTTCTCAAAGG + Intergenic
947983224 2:234427336-234427358 CCCCAGAGCCTGCTTGTCAAAGG - Intergenic
1168756824 20:324369-324391 TCCCAGCTCCTGCTTCCCAAGGG + Intergenic
1171355882 20:24545111-24545133 TCTCAGCTCCTGGTTCTCAATGG - Intronic
1171882901 20:30631334-30631356 TCCCAGGTCCTGCTTTTCCAGGG - Intergenic
1175163239 20:57024202-57024224 CCAGAGATCCTGCTTCTGATTGG - Intergenic
1177389636 21:20451116-20451138 TCCTATCTCCTGCTTCTCATTGG - Intergenic
1177563781 21:22792212-22792234 TCTTAGATCCTGCTGATCAAGGG + Intergenic
1184158181 22:42682677-42682699 TCCGAGAACCAGCTGCTCAGAGG + Intergenic
1184731927 22:46375304-46375326 ACCCAGACCCTGCCTCTCAATGG + Intronic
960185105 3:114628591-114628613 TCCTAAATCCTGCTTGGCAATGG - Intronic
960726407 3:120674781-120674803 CCCAAGATCCTGCTTCTTATAGG - Intronic
960950385 3:122995159-122995181 CCCGATGTCCTGCTTCTCACAGG - Intronic
963904088 3:150759593-150759615 TCCAAGCACCTGCATCTCAAAGG - Intronic
964535232 3:157714323-157714345 CTCGAGATTCTCCTTCTCAAGGG + Intergenic
967046081 3:185738296-185738318 TCCCAGATCCTGCCTTTAAAGGG + Intronic
970110835 4:12636232-12636254 TCCAGGATCCTGGGTCTCAAAGG + Intergenic
970322198 4:14886000-14886022 TCCTAGATCCTCCTTCTGAGAGG + Intergenic
972758627 4:42079014-42079036 TCGGATATCCAGATTCTCAAAGG - Intronic
973366582 4:49213738-49213760 TCCCAGGTCCTGCTTTTCCAGGG - Intergenic
981809134 4:148753559-148753581 TCTGAGATAATGCTTCTCATAGG - Intergenic
985061464 4:186083557-186083579 CCCGAAAACCTTCTTCTCAACGG - Exonic
986669626 5:10131505-10131527 TCCTGGCTCCTGCTTCTCAGAGG - Intergenic
990646965 5:57856138-57856160 TTTGAGATCCTGGTTCTCAAAGG - Intergenic
1002415021 5:179115845-179115867 TCTGATGTCCTGCTTCTTAATGG + Intronic
1003859707 6:10311219-10311241 TCTGTGATACAGCTTCTCAAGGG - Intergenic
1009809089 6:68637901-68637923 CCCTAAATCCTGGTTCTCAATGG + Intronic
1011182393 6:84635516-84635538 TTTGAAATCCTGCTGCTCAAGGG + Intergenic
1011681668 6:89789400-89789422 TTTGAGATCCTGCTTCTTAGTGG - Intronic
1016298986 6:142608558-142608580 TCCAAGATAGTGGTTCTCAAAGG - Intergenic
1016531116 6:145059002-145059024 TTAGAGATCCTTGTTCTCAAAGG + Intergenic
1017014418 6:150088747-150088769 CACCAGTTCCTGCTTCTCAAAGG + Intergenic
1018276987 6:162143439-162143461 GCAGAGATCCTGGTTCTCAGTGG + Intronic
1019106480 6:169671690-169671712 TCCGAGATCCTGCTTCTCAAAGG + Intronic
1024823401 7:53360858-53360880 ACCTAGACCCTGCCTCTCAATGG + Intergenic
1027257071 7:76437796-76437818 GCCTAGACCCTGCTTCTAAAAGG + Intronic
1027281779 7:76614246-76614268 GCCTAGACCCTGCTTCTAAAAGG - Intronic
1028060996 7:86315699-86315721 TTAGAGATCCTTGTTCTCAAAGG + Intergenic
1029180525 7:98698153-98698175 TCCAAGATCCTGCTGCTAACTGG - Intergenic
1031462333 7:122067098-122067120 CCATAGACCCTGCTTCTCAATGG - Intergenic
1035270905 7:157719314-157719336 GCGGAGATCGTGCTTCCCAAGGG + Intronic
1046711060 8:117512188-117512210 TCCCAGATCCTGCTTCTCTTTGG + Intergenic
1052121306 9:24720540-24720562 TCTGGAATACTGCTTCTCAAGGG - Intergenic
1060432977 9:123566338-123566360 TCAAAGATCCTGGTTCTCCATGG + Intronic
1060685927 9:125612678-125612700 TAAGAGATCCTGATTCCCAAAGG + Intronic
1189231776 X:39457937-39457959 TTCTATATCCTGCTTCTCCATGG + Intergenic
1194155816 X:90387396-90387418 TCCGAGATATTGCTTCTCTTAGG - Intergenic
1198247975 X:134849820-134849842 TCCTGGATCCCACTTCTCAATGG + Intronic