ID: 1019106489

View in Genome Browser
Species Human (GRCh38)
Location 6:169671749-169671771
Sequence TTGTGAGTGTGCAGAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 584}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019106489_1019106491 -1 Left 1019106489 6:169671749-169671771 CCTTCTCCTCTGCACACTCACAA 0: 1
1: 0
2: 5
3: 43
4: 584
Right 1019106491 6:169671771-169671793 ATTCACAGCCACTCAGTCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019106489 Original CRISPR TTGTGAGTGTGCAGAGGAGA AGG (reversed) Intronic
900320845 1:2082870-2082892 GTGTGAGGGTGCAAGGGAGAGGG + Intronic
900489047 1:2937233-2937255 TAAGAAGTGTGCAGAGGAGAGGG + Intergenic
901146040 1:7065246-7065268 TGGTGATGGGGCAGAGGAGAAGG + Intronic
902196996 1:14805184-14805206 CTGTGAGAGTCCAGAGGAGGTGG + Intronic
902744504 1:18464456-18464478 GTGTGTGTGTGCAGAGCAGAGGG - Intergenic
902784469 1:18724138-18724160 TAATGAGTTTGCAGAGGAGCCGG - Intronic
905289796 1:36913341-36913363 ATGAGAGTGGGCAGAGGCGAGGG + Intronic
905615118 1:39391413-39391435 ATGTGTGTGTGGAGAGGAGGAGG + Intronic
905758093 1:40529509-40529531 TTGAGAGAGAGGAGAGGAGAGGG + Intergenic
905775510 1:40665263-40665285 ATGTGAGTGTGCAGGGGCGGGGG - Intronic
905806422 1:40880814-40880836 TTGTTAGTGAATAGAGGAGAGGG + Intergenic
905950123 1:41943561-41943583 TTGTCTGTGTGTAGAGAAGATGG - Intronic
906033695 1:42738390-42738412 TTGTGATTGTGCAGGAGTGAGGG + Intronic
907113949 1:51952168-51952190 CTGTGAGTGTTCTGAGGATAGGG - Intronic
907279827 1:53340112-53340134 CTGTGACACTGCAGAGGAGAGGG + Intergenic
907481420 1:54747947-54747969 GTGTGAGTGTGCTGAGTGGATGG + Intergenic
907909772 1:58815590-58815612 TTCTGAGTGATCAGTGGAGAAGG - Intergenic
908040597 1:60108359-60108381 TTGTGAGTGTGAAGTGAAGGAGG - Intergenic
908253723 1:62285407-62285429 GCGTAAGTGTGGAGAGGAGAGGG - Intronic
908536949 1:65087125-65087147 TGGTGTGTGTGCACAGAAGAAGG + Intergenic
909163210 1:72181417-72181439 TAGTGAGTGTGTGGAGAAGAGGG + Intronic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
911152532 1:94609179-94609201 TTCTGAGCCTGCAGAGGAAAAGG - Intergenic
911311109 1:96293091-96293113 GTGTGTGTGGGCAGTGGAGAGGG + Intergenic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
912212738 1:107572385-107572407 TTGTGTGTGTGCGGGGGAGGTGG + Exonic
913018554 1:114764103-114764125 CTGTGAGTGTGCAGAAGTCAAGG + Intergenic
914999479 1:152575521-152575543 TTGTAAGGTTGCAGAGGAAAAGG + Intronic
916380368 1:164203493-164203515 TATTGAGTGGGCTGAGGAGAAGG - Intergenic
917680667 1:177363457-177363479 TGGTGAATGAGCAGAAGAGAAGG + Intergenic
918057839 1:181037964-181037986 AAGAGAGTGTGGAGAGGAGAAGG - Intronic
918805821 1:189042441-189042463 TTGTGAGAATGCAGAGAAAAGGG - Intergenic
919037885 1:192339610-192339632 TTACGTCTGTGCAGAGGAGATGG - Intronic
919825122 1:201498182-201498204 TAGTGAGTGTGGAGAACAGATGG + Intronic
919981429 1:202644619-202644641 TCCTGAGTGTGCAGAGTGGAAGG - Intronic
920534842 1:206730762-206730784 CTGTGAGTGTGCTGGGGAGGGGG + Exonic
920969492 1:210730913-210730935 TGGTTGGTGTCCAGAGGAGAGGG - Intronic
921743253 1:218709951-218709973 TTGTGACTGTGAAGAGGGGAAGG + Intergenic
923374497 1:233347048-233347070 GTGTGTGTGTGTAGAGGAGCGGG + Intronic
1062958422 10:1555349-1555371 TTGTGAGGTTGCAGAGAAAAGGG - Intronic
1063374400 10:5545385-5545407 CTGTGTGTGTCCAGTGGAGAAGG + Intergenic
1063578261 10:7281311-7281333 TAGTGGGAGTGCAGAGCAGATGG + Intronic
1064274121 10:13891400-13891422 GTGTGTGTGTGCCGAGGGGAGGG + Intronic
1064935552 10:20675053-20675075 TTGTGAGTGGGAGGAGGAAATGG + Intergenic
1065626037 10:27629540-27629562 TTGTTAGTGGGAAGAGGAGGTGG + Intergenic
1066565140 10:36714209-36714231 TGGTGAGGGTGCAGAGAAGAAGG + Intergenic
1067439031 10:46297910-46297932 CCGTGAGTGGGCAGAGGTGAGGG + Exonic
1069187473 10:65443233-65443255 TGGTGAGGTTGCAGAGGAAAGGG + Intergenic
1070201278 10:74208150-74208172 TTCTGAGTCTGCAGGGGAAAGGG + Intronic
1073281597 10:102358536-102358558 TTCTGAACTTGCAGAGGAGATGG - Exonic
1073759010 10:106610762-106610784 TCATGAGTGAGCAGAGGAGTGGG - Intronic
1074457475 10:113607909-113607931 TGGTGAGTGAGAAGAGGAGAAGG + Intronic
1074560492 10:114531412-114531434 TTGTGAGTTTTCAGATGAGAAGG + Intronic
1075629837 10:123994365-123994387 TTGTAAGGGTTCAGAAGAGAGGG + Intergenic
1076398243 10:130157361-130157383 ATGGGGGTGTGCGGAGGAGAGGG + Intronic
1077670911 11:4156827-4156849 TTGGGAATGAGGAGAGGAGAGGG - Intergenic
1077783464 11:5357229-5357251 GTGTGTGTGTGCACATGAGATGG - Intronic
1077785162 11:5375564-5375586 GTGTGTGTGTGCACATGAGATGG - Intronic
1078526549 11:12105829-12105851 GAGTGGGTGTGCAGAAGAGAGGG - Intronic
1078698956 11:13662415-13662437 TAGTGAGAATGCAGAGGACAGGG - Intergenic
1079534339 11:21493096-21493118 TAGTGAGTATGCAGAGAAAAGGG + Intronic
1079809718 11:24982118-24982140 TTGTGAGGTTGCAGAGAAAAGGG + Intronic
1080791957 11:35529266-35529288 TTGGGAGTTTGCAAATGAGAAGG - Intronic
1082639791 11:55644500-55644522 TGGTGAGTGTGTAGAGCAAAGGG + Intergenic
1082901150 11:58254094-58254116 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1083536239 11:63469019-63469041 GTGTGGGTGTGCAGAGGATGGGG - Intronic
1083840622 11:65302186-65302208 ATGGGAGTGAGCAGAGAAGATGG - Intronic
1083966237 11:66045550-66045572 TTTGCAGTGGGCAGAGGAGATGG + Intronic
1084477139 11:69395499-69395521 TCGTGTGTGGGCAGGGGAGAAGG + Intergenic
1085817313 11:79753094-79753116 TGGTGAGGATGCAGAGGAAAGGG + Intergenic
1086144450 11:83536328-83536350 TTGCTGGTGTGCTGAGGAGATGG - Intronic
1086768332 11:90728136-90728158 TGGTGAGATTGCAGAGGAAAAGG - Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087848801 11:103004469-103004491 TGGTGAGGTTGCAGAGGAAAAGG + Intergenic
1088187679 11:107191120-107191142 TTGAAAGTGTGCAGTGGGGAGGG + Intergenic
1088451165 11:109982732-109982754 TGATGAGTGTTCACAGGAGATGG - Intergenic
1088884160 11:113994165-113994187 CTCTGAGTGTGCAGAGGCAAAGG - Intergenic
1089496806 11:118912143-118912165 CTGTGAGTGTGTGGAGGAGGAGG - Intronic
1089566975 11:119376810-119376832 ATGTGAGACTGCAGAGAAGATGG - Intronic
1090833977 11:130440383-130440405 TGGAGAGGGTGCAGGGGAGACGG + Intergenic
1091448815 12:560165-560187 TGGTGAGGGAGCAAAGGAGAGGG + Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092064093 12:5575153-5575175 TTGTGGGTGCTCAGAGGAGAGGG - Intronic
1092750172 12:11711504-11711526 ATGTGAGAGTGCAGGAGAGAAGG - Intronic
1093837858 12:23858553-23858575 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
1094408486 12:30145016-30145038 TTGTCAGTGAGCAAAGCAGAAGG + Intergenic
1095524494 12:43109197-43109219 TGGTGAGTGTGCCAGGGAGAAGG - Intergenic
1095966517 12:47870736-47870758 CTGTGACAGTGCAGTGGAGATGG - Intronic
1096049105 12:48591266-48591288 TGGTGAGTTTGCAGAGAAAAAGG + Intergenic
1096217567 12:49806677-49806699 TTGGGTGTGTGCAGAGGAGTGGG - Intronic
1096237956 12:49942598-49942620 TTCAGAGAGTGCAGGGGAGACGG + Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098064153 12:66594311-66594333 TTGGGAGTGAGCACAGGAGAAGG + Intronic
1099096040 12:78376184-78376206 TTGTGTGGGTGCAGAGTAGGTGG - Intergenic
1099367087 12:81780581-81780603 CTGTGAGGTTGCAGAGGAAAGGG + Intergenic
1099481369 12:83170437-83170459 TTTTGAGAATGCAGGGGAGAAGG - Intergenic
1099717626 12:86316224-86316246 TGGTGAGGCTGCAGAGGAAAGGG + Intronic
1100962251 12:99975453-99975475 TGGTGAGGCTGCAGAGGAAAGGG - Intronic
1101407342 12:104440522-104440544 GGGTCAGTGTTCAGAGGAGATGG + Intergenic
1101472854 12:105014954-105014976 CTGTGAGTGGGCAGAGCTGATGG + Intronic
1101696668 12:107133515-107133537 TTGGGAGGGTGAAGAGAAGAGGG + Intergenic
1101891044 12:108715641-108715663 TTGTGAGTATGCGGGGGGGAGGG - Intronic
1103125248 12:118416521-118416543 TTGTGAGGACGCCGAGGAGAAGG - Exonic
1103443133 12:120978398-120978420 ATGGGAGTGGGCAGAGGGGAGGG - Intergenic
1103830452 12:123775051-123775073 CTGTGTGTGTGCAGAGGGCATGG + Intronic
1106360129 13:29023450-29023472 ATGTGTGTGTGCATATGAGAAGG - Intronic
1106570275 13:30920875-30920897 TTGTGAGGGAGCAGAGAGGAAGG + Intronic
1106607347 13:31241404-31241426 ATGCAAGTGTGCAGAGGAGGTGG + Intronic
1106844250 13:33720604-33720626 TTCTAAGTGTGCACAGGAAATGG - Intergenic
1107737262 13:43412919-43412941 TTATGAGTGTCCAGAGGGGCAGG + Exonic
1108342935 13:49515445-49515467 GTGTGTGTGTGTATAGGAGATGG - Intronic
1108458487 13:50641497-50641519 TTGCAAGTCTGCAGAGGAAATGG - Intronic
1109078016 13:57863307-57863329 TTCTAAGGGTGCACAGGAGAAGG + Intergenic
1109133217 13:58613976-58613998 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
1109333484 13:60961445-60961467 TTGTGAGAGTGTGGAGGAAAAGG - Intergenic
1109881191 13:68479248-68479270 TAGAGAGGGTGCAGAGAAGATGG + Intergenic
1111481170 13:88828865-88828887 TTGTGAGGGTGCAAAGAAAAAGG + Intergenic
1111588605 13:90313575-90313597 TTGTGAATGTGCATAGGAGCAGG + Intergenic
1112964005 13:105164854-105164876 TTTTGAGTGAGGAAAGGAGAAGG - Intergenic
1113120765 13:106921840-106921862 TTGGGAGAGTGCATAGGATAGGG + Intergenic
1113193565 13:107778671-107778693 TTTTCAGTGTGGACAGGAGATGG + Intronic
1113542266 13:111118095-111118117 TTGTGAGCCTGCAGAGGCGAAGG - Intronic
1113697876 13:112360375-112360397 TGGTGAGGATGCAGAGGAAAGGG - Intergenic
1114127632 14:19748279-19748301 TTCTGAGTGTGTAGATGAGGGGG - Exonic
1114245865 14:20912831-20912853 GTGTGTGTGTGCACATGAGATGG - Intergenic
1114848401 14:26352179-26352201 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1115393447 14:32879415-32879437 ATGTGAATGTGCAGAGAGGAGGG - Intergenic
1115760842 14:36578775-36578797 CTTGGAGTGTGCAGTGGAGAAGG - Intergenic
1115850632 14:37587755-37587777 TTGGGAGTGAGCATAGGACAGGG - Intergenic
1115886035 14:37972381-37972403 TTGAGATGGTACAGAGGAGAAGG + Intronic
1116138244 14:40955101-40955123 TTGTGAGTTTACAGAGAAAAGGG - Intergenic
1116231716 14:42226895-42226917 TGGTGAGGCTGCAGAGGAAAAGG - Intergenic
1116242490 14:42363075-42363097 TTGTAAATGTGCAGAGGGAAGGG + Intergenic
1116705833 14:48298052-48298074 TTCTGAGTTTGAGGAGGAGATGG - Intergenic
1117103949 14:52379935-52379957 TTCTGAGGGAGGAGAGGAGAGGG + Intergenic
1119266253 14:73264693-73264715 CTGTGGGTGTGAAGAGGGGATGG - Exonic
1119876868 14:78067566-78067588 TGGTGAGGTTGCAGAGAAGAGGG - Intergenic
1120142135 14:80941421-80941443 TGGAGTGTGTGCAGAGGTGAGGG - Intronic
1120687857 14:87559129-87559151 CTCTGAGTGTTCAGAGGAGAAGG + Intergenic
1121276419 14:92671171-92671193 TCGTGAGTGTGCTGAGGGCATGG - Intronic
1121706225 14:95996458-95996480 TGGTGAGTTTGCAGAGAAAAAGG - Intergenic
1122020731 14:98835984-98836006 CTGTGAGTGAGCAGAGGTGTGGG - Intergenic
1123571084 15:21609953-21609975 TTCTGAGTGTGTAGATGAGGGGG - Intergenic
1123607196 15:22045310-22045332 TTCTGAGTGTGTAGATGAGGGGG - Intergenic
1124253259 15:28121569-28121591 TTGTGAGGGTGCAGGGGAACAGG + Intronic
1124497120 15:30193354-30193376 TCCTGAGTGTGCAGAGCAGAAGG - Intergenic
1124746456 15:32345293-32345315 TCCTGAGTGTGCAGAGCAGAAGG + Intergenic
1125825457 15:42672636-42672658 TTGTGTGTTTGCAGAGAGGAGGG + Intronic
1127307934 15:57726532-57726554 TAGTGATTGTGAAGATGAGAAGG - Intronic
1127385515 15:58463426-58463448 TTGAGAGGGTGGAGAGGAGTGGG - Intronic
1127551688 15:60044782-60044804 TTGTGGGTGAGGAGAGGAGGTGG - Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128396149 15:67228481-67228503 TGGTGAGGTTGCAGAGGAAAGGG + Intronic
1128952579 15:71902006-71902028 TTGTGAGGCTGCAAAGGTGAAGG + Intronic
1129113259 15:73350670-73350692 CTGTGACTGGGAAGAGGAGATGG - Intronic
1129811686 15:78516302-78516324 TTTTGAGTGGGCTGAGGAGGAGG + Intronic
1130139046 15:81208010-81208032 TGGTGAGGTTGCAGAGGAAAGGG - Intronic
1130756778 15:86772578-86772600 TTAAGAGTGAGCAGAGAAGAGGG + Intronic
1131393672 15:92069716-92069738 ATGGGAGTGTTCAGATGAGAGGG - Intronic
1131904012 15:97121192-97121214 TAGTGAGGGTGCAGAGAAAAGGG + Intergenic
1202979436 15_KI270727v1_random:337077-337099 TTCTGAGTGTGTAGATGAGGGGG - Intergenic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1132773966 16:1581703-1581725 TAGGGAGTCTACAGAGGAGAGGG + Intronic
1133518310 16:6531349-6531371 TTGTGGGTGAGCTGAGGAGCAGG + Intronic
1134166431 16:11933717-11933739 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134196825 16:12165732-12165754 TTTTGTGTGTTCAGTGGAGACGG + Intronic
1134286413 16:12865826-12865848 TCATGAGTGTGCATATGAGACGG - Intergenic
1134494282 16:14720012-14720034 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134499663 16:14759132-14759154 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134526211 16:14945759-14945781 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134546197 16:15110614-15110636 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134555570 16:15160963-15160985 TTGTGTGTGTTTTGAGGAGAAGG + Intergenic
1134580913 16:15369912-15369934 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134713789 16:16344230-16344252 GTGAGAGTGAGGAGAGGAGAAGG - Intergenic
1134721659 16:16387584-16387606 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1134945767 16:18324291-18324313 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1134953028 16:18364427-18364449 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1135311822 16:21411134-21411156 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1135447069 16:22527751-22527773 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136146293 16:28318481-28318503 TTGTGAATGTGCAGTGCTGAAGG + Intronic
1136150991 16:28349034-28349056 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136167225 16:28462874-28462896 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136195752 16:28652142-28652164 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136212090 16:28766267-28766289 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136256809 16:29046195-29046217 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1136308526 16:29390141-29390163 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136321941 16:29491667-29491689 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136332165 16:29587355-29587377 TTGTCAGTGTGTAGAGGAATTGG - Intergenic
1136436622 16:30231640-30231662 GTGAGAGTGAGGAGAGGAGAAGG + Intronic
1136446862 16:30327425-30327447 TTGTCAGTGTGTAGAGGAATTGG - Intergenic
1136933126 16:34436366-34436388 TTTGCAGTGTGCAGAGCAGAAGG - Intergenic
1136971446 16:34975448-34975470 TTTGCAGTGTGCAGAGCAGAAGG + Intergenic
1138637615 16:58353921-58353943 TGGTGAGAATGCAGAGGAAAGGG - Intronic
1139409674 16:66749474-66749496 TTGGGAGGGTGGGGAGGAGAGGG + Intronic
1139856227 16:69982550-69982572 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1140366501 16:74385527-74385549 GTGAGAGTGAGGAGAGGAGAAGG - Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141221409 16:82072532-82072554 TTGTCAGTGTGCCAAGGAGGAGG - Intronic
1142184251 16:88686876-88686898 CTGTGAGTTTGCAGAAGGGATGG - Intergenic
1142363844 16:89639528-89639550 GTGTGTGTGTGCAGAGGTGGGGG - Intergenic
1143471059 17:7176198-7176220 TTGTGAGTGTGAGAATGAGATGG - Intronic
1143989490 17:10944588-10944610 GTGTGTGTGTGCACAGAAGAGGG + Intergenic
1144979349 17:19158948-19158970 ATGTGGAAGTGCAGAGGAGAAGG - Exonic
1144988873 17:19219284-19219306 ATGTGGAAGTGCAGAGGAGAAGG + Exonic
1145201162 17:20946071-20946093 TTGTGAGTTTGCAGAGAAAAGGG - Intergenic
1145903090 17:28500413-28500435 AAGGGGGTGTGCAGAGGAGAAGG + Intronic
1146542181 17:33706099-33706121 TTGAGAGTGTGATGAAGAGAAGG - Intronic
1147322825 17:39656477-39656499 TTGAGAGGGTGAAGTGGAGACGG - Intronic
1148677121 17:49451926-49451948 TAGTCAGTGTGCTGAGGGGAGGG + Intronic
1149392196 17:56203352-56203374 ATGTGAATGGGCACAGGAGATGG - Intronic
1149623664 17:58064600-58064622 TTCAGGGTGTGCAGAGGTGAGGG - Intergenic
1149985082 17:61341132-61341154 GTGTGAGTGTGCTGAGGGCATGG + Intronic
1150455647 17:65304630-65304652 CTGTGAATGTGCAGAAGATAAGG + Intergenic
1150601983 17:66659061-66659083 ATCTGAATTTGCAGAGGAGAGGG - Intronic
1150614791 17:66761920-66761942 GTGGGAGTGAGCAAAGGAGAGGG + Intronic
1150997358 17:70334009-70334031 TAATGAGTGAGCAGAGGAAAGGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152293435 17:79453600-79453622 TTAAGAGTGTGCAGAAGAGTGGG + Intronic
1152349313 17:79775056-79775078 TTGCAAATGTGCAGAGGAGCTGG + Intergenic
1152466692 17:80470685-80470707 GTGTGCGTGTGCAGGGGCGACGG + Exonic
1153026640 18:678905-678927 CTGTGTATCTGCAGAGGAGAAGG + Intronic
1153248059 18:3093034-3093056 TTTTGAAAGTGGAGAGGAGACGG + Intronic
1154117699 18:11625776-11625798 GTGAGAGTGAGGAGAGGAGAAGG + Intergenic
1155261200 18:24044220-24044242 TCGGGAGTCTGAAGAGGAGAGGG + Intronic
1155351575 18:24912615-24912637 TTTTGTCTGTGAAGAGGAGATGG - Intergenic
1156061823 18:33086807-33086829 TGGTGTGTGTGAAGGGGAGAGGG + Intronic
1156751575 18:40463894-40463916 TGGTGAGGTTGCAGAGGAAAGGG - Intergenic
1156760890 18:40588863-40588885 ATGTGAGTGTGGGGATGAGATGG - Intergenic
1156801426 18:41119377-41119399 GTGTGAGTGTTCTGGGGAGAAGG - Intergenic
1156848234 18:41694881-41694903 TTGTGTGGGTAAAGAGGAGATGG - Intergenic
1157407112 18:47431125-47431147 TGGTAAGTGTGTAGAGGAAAGGG - Intergenic
1157427584 18:47597215-47597237 ATGGGAGTGTGCTGAAGAGAGGG - Intergenic
1157679990 18:49597581-49597603 GTGTGTGTGTGCAGAGGGAAAGG + Exonic
1157794000 18:50559150-50559172 TTGGGAGTTGGGAGAGGAGAAGG + Intergenic
1158409234 18:57189850-57189872 TTGTGTGTGTGCAGAGGTGAAGG + Intergenic
1158524075 18:58196916-58196938 TTATGAGGGGGAAGAGGAGATGG + Intronic
1159136193 18:64339565-64339587 TTGTGAGTTTGCAAAAGAGAAGG + Intergenic
1159306227 18:66646583-66646605 ATGGGAGGGTGCAGAGGAAATGG - Intergenic
1159612161 18:70538137-70538159 ATGTGGTGGTGCAGAGGAGATGG + Intergenic
1159620881 18:70636990-70637012 ATGTGAAAGTGCAGATGAGAAGG - Intronic
1159793087 18:72808458-72808480 GTGTGTGTGTGGTGAGGAGATGG + Intronic
1160050249 18:75426750-75426772 TTCTGACTGTGAAGAGGAGATGG - Intronic
1160113052 18:76052107-76052129 TTGTGAGTGAGCAGGAGGGAAGG - Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1161316507 19:3619927-3619949 TGGGCAGGGTGCAGAGGAGACGG - Intronic
1162105019 19:8364852-8364874 GTGTGTGTGTGTAGAAGAGACGG - Intronic
1164906690 19:31973848-31973870 GTGGGAGTGGGCAGAGGAGAAGG + Intergenic
1166340087 19:42132259-42132281 TTGCTAGAGTACAGAGGAGAAGG + Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1167206570 19:48106440-48106462 TAGTGAGTGTCAAGAGGTGAGGG - Intronic
1167404739 19:49298561-49298583 TGGTGAGGCTGCAGAGGAAAGGG + Intronic
1167769091 19:51502596-51502618 TTGTGAGAGAGCAGTGGTGAAGG - Intergenic
1168056573 19:53868067-53868089 TTGGGGTTCTGCAGAGGAGAGGG + Intronic
1168632573 19:57968884-57968906 GTGTGAGTTTGAAAAGGAGATGG - Intronic
1168633016 19:57972021-57972043 TAGCAAATGTGCAGAGGAGAAGG + Intronic
925160158 2:1677928-1677950 GTGTGTGTGTGCAGCGGAGATGG + Intronic
925363456 2:3295420-3295442 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363602 2:3296128-3296150 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925376575 2:3389933-3389955 TTGTGAGTATGCAAAAAAGAAGG + Intronic
926150334 2:10422376-10422398 TGGTGGGTGTACAGAGGAGACGG - Intronic
927507254 2:23622561-23622583 TTGGGAGAGTCCAGAAGAGATGG - Intronic
927812636 2:26188453-26188475 CTTTGAGTGTGCAGAGTACATGG + Exonic
928424327 2:31165679-31165701 TTGAGAGTGTGGTGGGGAGAGGG - Intergenic
929083746 2:38147608-38147630 TGGTGAGGCTGCAGAGGAAAGGG + Intergenic
929099936 2:38301931-38301953 TTCTGCGTGAGGAGAGGAGAGGG + Intronic
929461014 2:42101971-42101993 TTGCGAGTGGGCAGAGGAGAGGG + Intergenic
929909657 2:46078756-46078778 ATGTGAGTGGGAGGAGGAGAAGG - Intronic
930483956 2:51988546-51988568 TTGTGTGTTTGCTGAGGAGTAGG - Intergenic
931027041 2:58122289-58122311 TTTTGACTGTGCAGGGGAGTGGG - Intronic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
931762485 2:65430802-65430824 TTATGAATGTGCAGGGGAGGAGG + Intronic
932324522 2:70848767-70848789 TGGTGAGGGTGCAGAGAAAAGGG + Intergenic
932998913 2:76896191-76896213 TTGTGTGTGTGCATAGGAGATGG - Intronic
933529168 2:83484311-83484333 TTGTGGAAGTACAGAGGAGAGGG - Intergenic
935430782 2:102973510-102973532 TTGTGAGTCAGCCCAGGAGAAGG + Intergenic
935491153 2:103722085-103722107 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
936547953 2:113409099-113409121 TTGTGAGTCCAGAGAGGAGAAGG + Intergenic
937018967 2:118633204-118633226 GTGTGAGTGGGGAGAAGAGAAGG - Intergenic
937025932 2:118697107-118697129 TTGTGAGTGTGGAGAGGGAGGGG + Intergenic
938377899 2:130820476-130820498 CTGTGAGTGCACAGAGGAAAGGG - Intergenic
938864192 2:135401452-135401474 TTGTGAGGGGGAAGGGGAGAAGG - Intronic
939013469 2:136874446-136874468 TGGTAACTGTGCAGAGAAGATGG - Intronic
939058289 2:137389152-137389174 TGGTGATGGTGCAGAGAAGAGGG - Intronic
939976484 2:148722532-148722554 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
940005948 2:149009828-149009850 TTGGGTGTGTGTAGAGGAAAGGG - Intronic
940176902 2:150888107-150888129 ATGTGAGTTGGCAGTGGAGAAGG - Intergenic
940308868 2:152255691-152255713 TAGTAAGTGTTCAGAGAAGAAGG + Intergenic
940389051 2:153109795-153109817 ATGTGAGTGTGCAGAAGGCAGGG + Intergenic
940449891 2:153824124-153824146 TGGTGAGCCTGCAGAGGAAAGGG + Intergenic
941170706 2:162132392-162132414 TAGTGGGAGTGCAGGGGAGAAGG - Intergenic
941574401 2:167212902-167212924 GTGTGTGTGTGCAGAGGGGTGGG - Intronic
941762961 2:169264993-169265015 CTGGGAGTGGGCAGAGGAAAGGG - Intronic
942897164 2:181070926-181070948 TTGTGAATTTGCAGAGGACATGG + Intronic
943530148 2:189069157-189069179 TTGTGGAGGTTCAGAGGAGAGGG - Intronic
944518096 2:200532412-200532434 CTGTGACTGGGCAGAGGAAAAGG - Intronic
944580124 2:201125219-201125241 GTGTGGCTGTGTAGAGGAGATGG + Intronic
944972907 2:205014470-205014492 CAGTGTGTGTGCCGAGGAGAAGG + Intronic
945540206 2:211076117-211076139 TGGTGAGGCTGCAGAGGAAAAGG + Intergenic
946110354 2:217409447-217409469 TTGTGTGTGAGGATAGGAGATGG - Intronic
946658509 2:221975157-221975179 TTGTGTGTATGTAGAGGGGAAGG - Intergenic
946756571 2:222953437-222953459 CTGTCAGTGTGGCGAGGAGAGGG - Intergenic
947330813 2:229027567-229027589 CTGTGAGTGTTCAGTGGAGGAGG + Intronic
947907868 2:233778737-233778759 TTATCAGTGTGTAGAAGAGAGGG + Intronic
947976961 2:234375094-234375116 TTGAGAGAGAGCAGAGGACAAGG - Intergenic
947990004 2:234479275-234479297 ATGTGAGTGTGCAGGGGCGCAGG + Intergenic
948798530 2:240419528-240419550 TCGTGGGTGTGGAGAGGAGCTGG - Intergenic
948918299 2:241049467-241049489 TTGTTAGTGTATAGATGAGATGG + Intronic
1168986647 20:2054776-2054798 TCGTGAGTGGGCAGAGAAAAAGG + Intergenic
1170161659 20:13319731-13319753 GTGTGTGTGTGCAGGGGGGAGGG - Intergenic
1170163052 20:13335313-13335335 GTGTGTGTGTGCATAGGTGAGGG - Intergenic
1170451019 20:16483823-16483845 TTGTGAGCTTGGAGAGGAGGGGG - Intronic
1170693402 20:18635562-18635584 TTCTGACTGTGCAGAGCAGTGGG - Intronic
1170886129 20:20341040-20341062 TTGTGTGTGCGCACAGGGGAAGG - Intronic
1170959912 20:21016099-21016121 TAGTGAATGTCCAGAGGAAACGG - Intergenic
1171379972 20:24727393-24727415 TGATGGGAGTGCAGAGGAGAGGG + Intergenic
1171530894 20:25852999-25853021 TTGTGAAGGTCCAGATGAGATGG - Intronic
1172789529 20:37493209-37493231 TGGTGAGGGTGTAGAGAAGAGGG + Intronic
1173032541 20:39375670-39375692 GTGTGTGTGTGTAGAGGAGGAGG + Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173198233 20:40933541-40933563 ATGTGACTGTGCAAAGGATATGG + Intergenic
1173347712 20:42216103-42216125 ATGTGAGTGTGGAACGGAGAAGG - Intronic
1173921942 20:46752881-46752903 TTTTGAGTGTGTACAGGAGATGG + Intergenic
1174136044 20:48380614-48380636 TTTTGAGTGTGCAGGGGCTATGG + Intergenic
1175790936 20:61739393-61739415 TGGTGAGTGTGCTGAGGTCAGGG - Intronic
1175793282 20:61756084-61756106 ATCAGAATGTGCAGAGGAGAAGG - Intronic
1176002544 20:62839518-62839540 ATGTGTGTGTCCAGATGAGAAGG + Intronic
1176285019 21:5014791-5014813 TTGTGGGTGTGCAAGGGAGGTGG - Intergenic
1176660981 21:9634738-9634760 CTGTGTGTGTGCAGCAGAGAAGG + Intergenic
1176943705 21:14954068-14954090 CTATGAGTGAGCAGAGGTGAAGG - Intergenic
1177084928 21:16691949-16691971 TTGTTAGTGTCCTGAGGAAATGG + Intergenic
1178180707 21:30157879-30157901 TTGTGAGTGTAAATAGGAAAGGG + Intergenic
1179031537 21:37724555-37724577 TAGTGAGTGTGGAGGGGAGTGGG + Intronic
1179327351 21:40360948-40360970 CTGTGAGGGTGCAGAGAAAAGGG - Intronic
1179588919 21:42392332-42392354 AAAAGAGTGTGCAGAGGAGAGGG + Intronic
1179872162 21:44248684-44248706 TTGTGGGTGTGCAAGGGAGGTGG + Intronic
1180031629 21:45212962-45212984 TTTTGAGTGTGCAGTGGGCATGG + Intronic
1180122767 21:45765065-45765087 TGGTGTGTGTGCAGAGGGCATGG + Intronic
1180588362 22:16914120-16914142 CTTTGAGTCTGCAGAGGAGAAGG - Intergenic
1181031597 22:20150831-20150853 CACTGAGTGAGCAGAGGAGATGG + Exonic
1181339166 22:22164850-22164872 TTGTGATTGTTCTGAGGAGAAGG + Intergenic
1181511795 22:23392686-23392708 CACTGAGTGAGCAGAGGAGATGG - Intergenic
1181734905 22:24874008-24874030 TTGTTAGTGGAAAGAGGAGAGGG + Intronic
1183260835 22:36794846-36794868 ATGTGAGGGCCCAGAGGAGAGGG + Intergenic
1184013001 22:41763445-41763467 TTAGGAGTGTGGAGAGGAGTAGG + Intronic
1184173317 22:42772226-42772248 CTCTGTGTGTGCAGAGGGGAAGG - Intergenic
1184252596 22:43269218-43269240 CTGTCAGAGTCCAGAGGAGATGG - Intronic
1184401726 22:44278501-44278523 TTGGGGGAGTGCTGAGGAGAAGG + Intronic
949524866 3:4893487-4893509 TGGTGAGGTTGCAGAGGAAAGGG + Intergenic
950566796 3:13774103-13774125 CTGTGAGTGCGCAGGGGTGAAGG + Intergenic
950673867 3:14542979-14543001 TTCTGGGTGTGCAGAGGAAGAGG + Intergenic
950716768 3:14853342-14853364 TTGTAAGTGGGCGGAGGGGAGGG - Intronic
950876762 3:16282569-16282591 TTGAGAGTATGAAGAGAAGAGGG + Intronic
951175486 3:19594150-19594172 TTGTGTGTGTGCACGTGAGATGG + Intergenic
951930297 3:27958272-27958294 TGGTGAGGTTGCAGAGGAAAAGG - Intergenic
952142088 3:30491352-30491374 TTGTGAGTGAGCAGTGGAAAGGG - Intergenic
952850023 3:37720184-37720206 TTTTGAATGAGCAGAGTAGAAGG + Intronic
954414022 3:50384175-50384197 CTGTGAGTGTGCAGAGCAATCGG - Exonic
954527720 3:51287644-51287666 TGGTGAGGTTGCAGAGAAGAGGG + Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954614914 3:51964558-51964580 TTGGGAGTGGGAATAGGAGAAGG - Intronic
954938117 3:54345549-54345571 TGGTGAGAGGGCAGAGGAGCTGG + Intronic
955090586 3:55746637-55746659 TTGTGCTTCTGCAAAGGAGAAGG + Intronic
955110552 3:55944881-55944903 TTGTTAGTCTACAGAGGACAAGG - Intronic
955279126 3:57577657-57577679 ATGTGAGAGTGCAGAGGGAAGGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958013623 3:87913444-87913466 TAGTGAGTTTGCAGAGAAAAAGG + Intergenic
958157316 3:89771445-89771467 CTGTGAGTGTGCAGAAGTCAAGG - Intergenic
958416419 3:93879605-93879627 TGGTGAATGTGCAAGGGAGAAGG - Intronic
958508127 3:95008521-95008543 TTGTGAATTTACAAAGGAGAAGG + Intergenic
959328927 3:104977051-104977073 TTCTGAGTGTGGATAGGAGAAGG + Intergenic
959667013 3:108933688-108933710 TGGTGAGGCTGCAGAGAAGAAGG + Intronic
959907643 3:111728413-111728435 TTGTGTGTGTGTAGGTGAGAGGG + Intronic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960346884 3:116544127-116544149 TGGTGAGTTTGCTGAGGAAAGGG + Intronic
960931577 3:122856395-122856417 TTGTGAGTGGACAGAGCAGGGGG + Intronic
961616813 3:128188948-128188970 TTGTGAGTCTGTAGGGGAGTTGG + Intronic
961667121 3:128499358-128499380 GTATGTGTGTGCGGAGGAGATGG - Intergenic
961930830 3:130531005-130531027 GTGTGTGTGTGTAGAGGAGGGGG - Intergenic
961988391 3:131161191-131161213 TTGTGAGGTTGCAGAGAAAAAGG + Intronic
962027600 3:131564966-131564988 TTGTGAGTGGGAAGTGGAGAAGG + Intronic
963019985 3:140863642-140863664 GGGAGAGTGTGGAGAGGAGAGGG + Intergenic
965284189 3:166796145-166796167 TAGTGAGGATGCAGAGGAAAGGG + Intergenic
965667590 3:171111518-171111540 TGGTGAGGATGCAGAGAAGAGGG + Intronic
966492610 3:180544971-180544993 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
966742808 3:183249904-183249926 TTGTGAGGGTGGCAAGGAGACGG + Intronic
967570007 3:191017324-191017346 TTGAGAAGGTGCAGAGGAGAAGG - Intergenic
967715179 3:192754310-192754332 TTGTGGGTGGGCAGAGGGAATGG - Intronic
968443803 4:638090-638112 TGGTGAGGGTGCAGAGCAGCAGG - Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969387775 4:6867301-6867323 ATCTGAGTGTCCAGAGTAGAAGG + Intronic
969890601 4:10256405-10256427 TGGTCAGTGTGCAAAGCAGAAGG - Intergenic
970032619 4:11693992-11694014 TTTTGAGTGTGGTGTGGAGAAGG + Intergenic
970263702 4:14257392-14257414 TTGTCAGGGTGTGGAGGAGAGGG + Intergenic
971034226 4:22675650-22675672 CTGTGAGTGTCCAGAAGAAAAGG + Intergenic
972249255 4:37281989-37282011 TTGTGTATGTACAGAAGAGATGG - Intronic
972595677 4:40527921-40527943 ATGTTAGTTTGCAGAAGAGAAGG + Intronic
975207069 4:71656832-71656854 TTGTGTGTGTGAAAAGGAGGAGG + Intergenic
975576876 4:75871832-75871854 TTAGGAGTGTGTGGAGGAGAAGG + Intronic
976096635 4:81515330-81515352 TAGGGAGTGAGCAGAGGGGAGGG + Intronic
977798523 4:101197489-101197511 TGGTGAGTGTGCAGAGTGCAAGG - Intronic
978035645 4:103990114-103990136 CTGTGAATGTGCAGAGAAAAGGG - Intergenic
978058020 4:104297281-104297303 TGGTGAGTTTGCAGAGAAAAAGG - Intergenic
978060875 4:104336689-104336711 TTGTGAGATTGCAGAGAAGAGGG - Intergenic
978340697 4:107719326-107719348 TTGTAAGTGTGCAGCAGGGAAGG - Intronic
979962897 4:127042383-127042405 TGGTGAGGATGCAGAGGAAAGGG + Intergenic
983710114 4:170704492-170704514 TGGTGAGTTTGCAGAGAAAAGGG - Intergenic
983936102 4:173503542-173503564 TGGTGAGTGTTGAGGGGAGATGG + Intergenic
984061059 4:174989549-174989571 ATGAGGGTGTGCAGAGGAGTAGG + Intergenic
984065207 4:175038863-175038885 TTGTGAATTTGCAGAGGCCAAGG + Intergenic
985230041 4:187805818-187805840 TAGTGAGAATGCAGAGAAGAGGG + Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
986226307 5:5817635-5817657 GAGTGAGTTTCCAGAGGAGATGG - Intergenic
986378107 5:7153674-7153696 TGGGGAGTGTGCAGAGAAAAGGG - Intergenic
986502825 5:8418010-8418032 TTGTGGGGTTGCAGTGGAGAAGG - Intergenic
986621287 5:9678289-9678311 TGGTGAGTTTGCAGAGAAAAGGG + Intronic
987809235 5:22812365-22812387 ATATGTGTTTGCAGAGGAGACGG - Intronic
987848756 5:23322273-23322295 TGGTGAGGCTGCAGAGAAGAGGG + Intergenic
987996629 5:25290474-25290496 TGGTGAGGCTGCAGAGGAAAAGG + Intergenic
988397551 5:30714175-30714197 ATGTGAGGATGCAGAGGAGCAGG + Intergenic
988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG + Intergenic
988820411 5:34878700-34878722 TGGTGAGGGTGCAGAGAAAAGGG + Intronic
988853244 5:35199715-35199737 TTGTAAATCTGTAGAGGAGAGGG + Intronic
989478829 5:41904466-41904488 TGGTGAGGGAGCGGAGGAGAGGG + Exonic
989775657 5:45204083-45204105 TTGTGAGTGGGTAGTGGACAAGG - Intergenic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
991302393 5:65141782-65141804 TTGTGAGGCTGCAGAGAAAAGGG - Intergenic
992134933 5:73734814-73734836 TTGTGTTTTTGCAGTGGAGAGGG + Intronic
992249217 5:74860771-74860793 TATGGATTGTGCAGAGGAGAGGG - Intronic
992381178 5:76239460-76239482 TAGACAGTGTGCAGAGGAGATGG + Intronic
992872761 5:81023068-81023090 TTGTGAGTGCGGAGGGTAGAGGG + Intronic
993134875 5:83947395-83947417 GTGTGTGTGTGCAGAGGTGCTGG + Intronic
994769509 5:103964303-103964325 TGGTGAGAGTGCAGAGAAAAGGG - Intergenic
995679385 5:114700039-114700061 TTGTGAGAGTGCATATGGGAAGG - Intergenic
995964938 5:117894041-117894063 TTGAGAGTATGCAAATGAGATGG - Intergenic
996611023 5:125380826-125380848 TATTGAGTGTGTTGAGGAGATGG + Intergenic
997606169 5:135177137-135177159 CTGTGAGGGTGCACAGGAGGTGG + Intronic
997958249 5:138297426-138297448 TTGAGAAGGAGCAGAGGAGAGGG - Intronic
998150560 5:139754952-139754974 GTGTGTGTGTGCAGTGGAGAGGG + Intergenic
999150330 5:149422432-149422454 TTGGAGGTGAGCAGAGGAGAAGG + Intergenic
1000234613 5:159345827-159345849 TTGTGTGTGTTCAGAGGTGAGGG + Intergenic
1000444452 5:161302641-161302663 TTGTGTGTGGGTAGAGGAGATGG + Intronic
1001165269 5:169359788-169359810 TTGTGAGGATGCAGAGAAAAGGG + Intergenic
1001753321 5:174147808-174147830 TGCTGAGGGTGCAGAGGTGAAGG - Intronic
1001760034 5:174199896-174199918 TGGTGAGACTGCAGAGGAAAGGG - Intronic
1001805906 5:174585977-174585999 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
1003858071 6:10296022-10296044 TTGTGAGTGGTCAGTGGAGCAGG + Intergenic
1004720687 6:18265188-18265210 GTGTGAGAGAGGAGAGGAGAAGG - Intergenic
1004955204 6:20721696-20721718 TGGTCAGGGTGCAGAGAAGAAGG - Intronic
1005445871 6:25922455-25922477 ATGTGAGTGTGCTGAGAAGCAGG + Intronic
1006620758 6:35362416-35362438 TGGTGAGTAGGCAGAGCAGATGG - Intronic
1007285227 6:40742786-40742808 ATGTGAGTGTGCATTGGGGAAGG - Intergenic
1007736658 6:43986296-43986318 TTGAGAATGGCCAGAGGAGAAGG - Intergenic
1008795392 6:55296526-55296548 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1009331773 6:62431439-62431461 TGGTGAGTCTGCAGAGAAAAAGG - Intergenic
1009498878 6:64386041-64386063 GTGGGAGTCTGCACAGGAGATGG - Intronic
1010016534 6:71110814-71110836 AGGTGAGTGTGGAGAGGACAAGG - Intergenic
1010024246 6:71197287-71197309 TTGAGGGTTGGCAGAGGAGACGG + Intergenic
1010535707 6:77026989-77027011 CTGTGAGTTTCCAGATGAGAAGG - Intergenic
1010833153 6:80555333-80555355 GTGTTAGTGTGCAGAGGAGAGGG + Intergenic
1011046222 6:83086393-83086415 CTGTGAGTGGGCAGAGGAAGAGG + Intronic
1013773156 6:113649878-113649900 TTCTGAGTGTGAAGAGGATTTGG - Intergenic
1014619364 6:123646562-123646584 TGTTGAGTGTGCTGAGGAAAAGG + Intergenic
1014707560 6:124766460-124766482 TTGTGAGTAGGCAACGGAGAGGG - Intronic
1016151099 6:140744339-140744361 TTCTGCTTGAGCAGAGGAGAGGG + Intergenic
1016286934 6:142484218-142484240 CTGGGAGTGGGGAGAGGAGAGGG - Intergenic
1016489512 6:144581863-144581885 TAGTGATTGTTCAGAGGGGAGGG - Intronic
1016764298 6:147774872-147774894 GTGTGTGTGTGAAGAGGAGGTGG - Intergenic
1016959413 6:149657197-149657219 TTGTGTATGTGAAGAGTAGAGGG - Intergenic
1017036332 6:150270420-150270442 TTGTCAGCCTTCAGAGGAGAAGG - Intergenic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1017812682 6:157995466-157995488 TTAGGAGTGTTCAGAAGAGAAGG - Intronic
1018004093 6:159604203-159604225 CTTTAAGTGTGCAGAGAAGAAGG - Intergenic
1018235968 6:161723939-161723961 AGGTGAGTGCGCAGTGGAGAGGG - Intronic
1018477230 6:164155522-164155544 TGGTGAGGGTGCAGAGAAAAGGG + Intergenic
1018652262 6:166002385-166002407 TTGTTTGGGTGCAGAGGGGAAGG - Intergenic
1018762663 6:166905237-166905259 ATGTGAGTGTGCAGGAGACAGGG - Intronic
1019106489 6:169671749-169671771 TTGTGAGTGTGCAGAGGAGAAGG - Intronic
1019265672 7:116286-116308 TCCTGAGTGTGGAGGGGAGATGG - Intergenic
1019650292 7:2153556-2153578 TGGTGAGGATGCAGAGGAAAGGG + Intronic
1020331538 7:7022339-7022361 TTGTGAGGTTGCAGAGAAAAAGG - Intergenic
1020762708 7:12288446-12288468 TTTTCAATGTGCAGAGGAAATGG - Intergenic
1021127755 7:16872959-16872981 TGGTGAGGATGCAGAGAAGAGGG + Intronic
1021842617 7:24733020-24733042 TTGTGCTTGAGGAGAGGAGAGGG + Intronic
1021957894 7:25844589-25844611 TTGTGTGTGTACAGATGAGATGG + Intergenic
1022180663 7:27916030-27916052 TTGTGTGTGTGCACAGGGGTGGG + Intronic
1022644950 7:32221116-32221138 TTGTCAGTTTGGAGAAGAGAAGG - Intronic
1022765719 7:33408841-33408863 TTGTGAGACTGCAGAGAAAAGGG - Intronic
1023081587 7:36531866-36531888 GTGTGCGTGTGCACAGGGGAGGG + Intronic
1023497207 7:40810400-40810422 TGGTGAGGCTGCAGAGAAGAAGG - Intronic
1023648360 7:42342812-42342834 TTGTGAGGCTGCAGAGAAGGGGG + Intergenic
1023858010 7:44197198-44197220 TTTTGATTGTGCAGTGGGGAGGG + Intronic
1024248199 7:47486179-47486201 TTGTGAGTTTGCATATGAGTGGG + Intronic
1024473401 7:49786615-49786637 TTGTGAGGCTGCAGAGAAAAGGG - Intronic
1025038371 7:55617698-55617720 TTGTGAGAATGCAGAGAAAAGGG - Intergenic
1025159861 7:56647108-56647130 TTTTGGGTATGCAGTGGAGAGGG - Intergenic
1025726858 7:64072228-64072250 TTTTGGGTATGCAGTGGAGAGGG + Intronic
1026796472 7:73369112-73369134 GTGTGTGTGTGAAGAGGGGATGG - Intergenic
1028644681 7:93082240-93082262 GTGTTAGTTTGCTGAGGAGAAGG - Intergenic
1029240199 7:99155323-99155345 TTGTCAGTGTTCAGCTGAGAAGG - Intergenic
1029649052 7:101878315-101878337 CAGTGAGTGTGCCTAGGAGAGGG + Intronic
1029970609 7:104785258-104785280 TTGGGAGTGTGAAGAGGGGATGG - Intronic
1030164800 7:106543434-106543456 TTGTGAGTGTGAGGAGGGCAGGG - Intergenic
1030659205 7:112202322-112202344 TGGTGAGAGTGCAGAGAAAAGGG - Intronic
1031143847 7:117975948-117975970 TTGTGAGAGGGCAGAGGGCAAGG - Intergenic
1031746062 7:125499612-125499634 GTGGGAGTTTGCAGGGGAGATGG - Intergenic
1032115182 7:129110871-129110893 CTGTGAGTGGGCAGTGGAGGAGG + Intergenic
1032778327 7:135139227-135139249 TAGTGAGGTTGCAGAGGAAAGGG - Intronic
1033222910 7:139540486-139540508 TGGTGAGTGTGCCAAGGTGAAGG + Exonic
1033586387 7:142777821-142777843 TGGTGAGGCTGCAGAGGAAATGG - Intergenic
1033771470 7:144557392-144557414 TAGTGTGTGTGGAGAGCAGAAGG - Intronic
1033867835 7:145713997-145714019 TTTTGCTTGTGAAGAGGAGAGGG - Intergenic
1034235097 7:149560574-149560596 TGATGAGTGTGCAGAGCAGGGGG + Intergenic
1034643558 7:152624342-152624364 TTGTGCTTGGCCAGAGGAGAAGG - Intergenic
1034759867 7:153661550-153661572 TTGAGAGTGTGCAGAGAATATGG + Intergenic
1034994997 7:155571558-155571580 ATGGGAGGGTACAGAGGAGAAGG - Intergenic
1035646908 8:1231345-1231367 TGGTGAGGGTGCAGAGAAAAGGG + Intergenic
1036542556 8:9731597-9731619 TTGTGTGTGTGCTGTGGCGATGG + Intronic
1036773113 8:11592409-11592431 TTGAGAGTGTGCTAAGGAGGTGG - Intergenic
1037585133 8:20270833-20270855 TTGTGTGTGTGGAGAGGGAAGGG + Intronic
1037916620 8:22777062-22777084 AGGTGAGTGTGCAGAGAAGCAGG + Intronic
1038093143 8:24277071-24277093 GTGTGAGTGTGCAGAAGTGGAGG - Intergenic
1038412097 8:27366844-27366866 AGGGGAGGGTGCAGAGGAGAGGG + Intronic
1038704047 8:29877504-29877526 TTGAGAGTGTGAAGATGATATGG - Intergenic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039418681 8:37417831-37417853 TTGTGTGTATGCAGTGGGGAGGG - Intergenic
1041475687 8:58262952-58262974 TGGTGAGTGTGCAGAGTAACCGG - Intergenic
1041750507 8:61255486-61255508 ATGTGTGTGTGGAGAGGTGAAGG + Intronic
1041776661 8:61530014-61530036 GTATGTGTGTGCAGAAGAGAGGG + Intronic
1042021148 8:64372189-64372211 TGGTGAGTGTAGAGAAGAGAAGG + Intergenic
1042102155 8:65285095-65285117 CTAGGAGTGTGCAGAGGAGGGGG - Intergenic
1042492208 8:69412433-69412455 TTGTAAGTTTGCAGAGGAGAGGG - Intergenic
1043012842 8:74901728-74901750 TCGTAACTTTGCAGAGGAGACGG - Intergenic
1043912988 8:85885297-85885319 TGGTGAGAGTGGAGAGGAGGAGG - Intergenic
1045300822 8:100908525-100908547 TTCTGAGCCTGCAGAGGAAAGGG + Intergenic
1045668148 8:104513791-104513813 TTGAGAGTGAGAAGAGCAGAGGG - Intronic
1045670228 8:104542859-104542881 TGGTGAGTAGGCAGAGGAGGAGG + Intronic
1047540711 8:125762896-125762918 ATGTTAGTGGGCAGAGGGGAAGG + Intergenic
1048671927 8:136732332-136732354 TTGTGTGTGAGTAGAGGAGGAGG - Intergenic
1048944001 8:139427695-139427717 TTGGGAGTCTGCAGAAGGGAAGG - Intergenic
1048995469 8:139791310-139791332 GTGTGTCTGTGCAGGGGAGACGG - Intronic
1048995501 8:139791565-139791587 GTGTGTCTGTGCAGGGGAGATGG - Intronic
1049163433 8:141112026-141112048 TTGGGAATGTGCAGAGGGGCTGG + Intergenic
1049431766 8:142568642-142568664 TTGTGGGTGTGGAAAGGAGGCGG - Intergenic
1049808444 8:144551972-144551994 TTGGGAGGGTGAGGAGGAGATGG - Intronic
1050021154 9:1285791-1285813 TGGAGAGTGTGCAATGGAGAAGG - Intergenic
1050839768 9:10134079-10134101 CTGTGAGTGTGCAGCAGGGATGG - Intronic
1050860129 9:10418436-10418458 GTGTGTGTGTGTAGAGGGGAAGG - Intronic
1051004545 9:12327329-12327351 TGGTGAGGGTGCAGAGAAAAGGG - Intergenic
1052525767 9:29617090-29617112 TTGTGAAAGTGCTGTGGAGAGGG + Intergenic
1052886416 9:33652542-33652564 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
1052902139 9:33802477-33802499 TGGTGAGGCTGCAGAGGAAAGGG - Intergenic
1053056640 9:34996885-34996907 GTGTGTGTGTGCTGGGGAGATGG + Intronic
1053510971 9:38687479-38687501 TGGTCAGTGTGCAGAGCAGGAGG - Intergenic
1053654479 9:40202204-40202226 TTGTGTGTGTGTAAAAGAGAGGG - Intergenic
1054366594 9:64348421-64348443 TTGTGTGTGTGTAAAAGAGAGGG - Intergenic
1054530117 9:66174109-66174131 TTGTGTGTGTGTAAAAGAGAGGG + Intergenic
1054674222 9:67838161-67838183 TTGTGTGTGTGTAAAAGAGAGGG - Intergenic
1054740477 9:68801144-68801166 TTGTGTGTGTGAGGAGGGGATGG + Intronic
1054753971 9:68938483-68938505 ATGTGAGTCTGCACATGAGATGG + Intronic
1055287748 9:74747277-74747299 TTGTTAGTAGGCTGAGGAGAAGG + Intronic
1055740588 9:79383927-79383949 TTCTTAGTTTGCAGAGGACATGG - Intergenic
1055782799 9:79837683-79837705 TTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1056519349 9:87385688-87385710 ATCTGAGTGTGCTGAGAAGAAGG - Intergenic
1056718217 9:89051416-89051438 TAGTGAGTGTGAAGAGGAATTGG - Intronic
1056823934 9:89863923-89863945 TTTGGAGTGGGCAGAAGAGAAGG - Intergenic
1056884170 9:90424111-90424133 GTGTGAGTGTGCAGTGAAGGGGG - Intergenic
1056886542 9:90448852-90448874 TTGTGAGTTTGCAGAGGGTGAGG - Intergenic
1057021580 9:91702009-91702031 TTGTGAGGGTGTAGAGAAGAGGG - Intronic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057746085 9:97752454-97752476 TTGAGAGTGAGCAGGGAAGAGGG + Intergenic
1058104195 9:100951555-100951577 TGGTGAGGGTGCAGAGAAAAGGG - Intergenic
1058524800 9:105846032-105846054 TTCTCAGAGTGCAGAGGAAAAGG + Intergenic
1058850141 9:109003805-109003827 TTGTGACTTTGGAGAGGATATGG + Intronic
1059369304 9:113812831-113812853 TTGTGTGTGTGGTGAGGGGAGGG - Intergenic
1059543256 9:115151582-115151604 TTGTGGGTGAGAAGAGGATATGG + Intronic
1059710953 9:116867249-116867271 GTGTAAGTGTGCCGAGGAGAGGG + Intronic
1059784008 9:117560867-117560889 TAGTGAGACTGCAGAGAAGAGGG + Intergenic
1060153771 9:121304874-121304896 TTGAGAGTGTTCTGAGGAGTTGG + Intronic
1061005182 9:127924863-127924885 GTGTGTGTGTGTAGAGGGGAGGG - Intronic
1061710031 9:132481095-132481117 TTGTGGGTGTGCAAAGCAGGTGG - Intronic
1061814962 9:133188998-133189020 TGGTGAGTCAGCACAGGAGATGG + Intergenic
1062041105 9:134404716-134404738 AGGGGAGTGTGCAGAGGAGCTGG + Intronic
1062571360 9:137187031-137187053 TTGTTAGTTTGGAGAGGAGAGGG - Intronic
1203638550 Un_KI270750v1:136582-136604 CTGTGTGTGTGCAGCAGAGAAGG + Intergenic
1185722397 X:2393365-2393387 TCTTGTGTGTGCACAGGAGATGG - Intronic
1185722409 X:2393437-2393459 TCATGTGTGTGCACAGGAGATGG - Intronic
1185722441 X:2393583-2393605 TGTCGTGTGTGCAGAGGAGATGG - Intronic
1185882459 X:3753689-3753711 TGGTGAGGTTGCAGAGGAAAAGG + Intergenic
1186018442 X:5226143-5226165 TGGTGAGGGTGCAGAGGAAAGGG + Intergenic
1186155179 X:6717833-6717855 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1186436120 X:9544361-9544383 GCCTGAGTGTGCAGAGGTGAGGG + Intronic
1187676181 X:21718759-21718781 TTGTCAGAGGGCAGAGGAGTGGG + Intronic
1187764037 X:22619897-22619919 TGGTGAGGTTGCAGAGAAGAGGG + Intergenic
1188493670 X:30761298-30761320 TTGTGAGGTTGCAGAGAAAAAGG + Intergenic
1188747230 X:33861080-33861102 ATGTAAGTTTGCAGTGGAGATGG + Intergenic
1188819117 X:34751877-34751899 TTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1189740915 X:44116432-44116454 TTGTGTGTGTTGACAGGAGAGGG - Intergenic
1189847308 X:45149343-45149365 CTGTGACTGTGCAGGTGAGAAGG + Exonic
1190050557 X:47145810-47145832 TTGAGTTTGTGCATAGGAGAGGG + Intronic
1191032729 X:55991736-55991758 TTGTGAGGTTGCAGAGGAAAGGG - Intergenic
1191154933 X:57264540-57264562 TGGTGAGTTTGCAGAGAAAAAGG + Intergenic
1193340583 X:80344433-80344455 TGGTGAGTTTGCAGAGAAAAGGG - Intronic
1193550379 X:82885084-82885106 TAGTGAGGTTGCAGAGAAGAAGG + Intergenic
1193787350 X:85775246-85775268 TTGTGAGTTGCCAGAGGATATGG - Intergenic
1193942441 X:87692206-87692228 TGGTGAGGCTGCAGAGGAAAGGG + Intergenic
1194355884 X:92883441-92883463 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
1194462808 X:94193994-94194016 GTGAGAGTGTGCTGAGGAGAAGG - Intergenic
1194838986 X:98715360-98715382 GTGGGAGTTTGCAGAGAAGAGGG + Intergenic
1194986590 X:100496423-100496445 GTGTGTGTGTGTAGAGGACAGGG + Intergenic
1195303507 X:103555747-103555769 GAGTGAGTGTGCAGAGAGGATGG - Intergenic
1196311946 X:114178673-114178695 TGTTGAGTAGGCAGAGGAGAAGG - Intergenic
1196970042 X:121098687-121098709 CTGAGAGTTTGCAGAGGATATGG + Intergenic
1197210391 X:123823586-123823608 TTCTCAGTGTGCAGATCAGATGG + Intergenic
1197469003 X:126843752-126843774 TGGTGAGTATGTAGAGAAGAGGG + Intergenic
1197798298 X:130321284-130321306 TGGTGAGGGTACAGAGGAGGAGG - Intergenic
1199641247 X:149864305-149864327 TGGTGAGGTTGCAGAGGAAAGGG + Intergenic
1199672065 X:150155728-150155750 TTTTGACCGTGCAGAGGAAAGGG - Intergenic
1200204197 X:154304075-154304097 TGGGGAGAGAGCAGAGGAGATGG + Intronic
1200664230 Y:6000418-6000440 TTGTGAGGTTGCAGAGAAAAGGG + Intergenic
1201476175 Y:14383860-14383882 TTGCGGGTGTGAGGAGGAGATGG - Intergenic
1201549245 Y:15202038-15202060 TCGTGAGGATGCAGAGAAGAGGG + Intergenic
1201745911 Y:17373312-17373334 GTGTGTGTGTGCAGAGGTGGGGG - Intergenic