ID: 1019106498

View in Genome Browser
Species Human (GRCh38)
Location 6:169671852-169671874
Sequence GACACAGTGGTGAATAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 977
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 926}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019106498_1019106505 24 Left 1019106498 6:169671852-169671874 CCCTTCCTATTCACCACTGTGTC 0: 1
1: 0
2: 1
3: 49
4: 926
Right 1019106505 6:169671899-169671921 TCAAGACCCCTTGCTGTGCAAGG 0: 1
1: 0
2: 1
3: 9
4: 97
1019106498_1019106502 -2 Left 1019106498 6:169671852-169671874 CCCTTCCTATTCACCACTGTGTC 0: 1
1: 0
2: 1
3: 49
4: 926
Right 1019106502 6:169671873-169671895 TCTCCAGCCTGAAATATTACAGG 0: 1
1: 0
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019106498 Original CRISPR GACACAGTGGTGAATAGGAA GGG (reversed) Intronic
900115359 1:1025755-1025777 GACACAGAGGTGAGTGGGGAGGG - Intronic
901145784 1:7063792-7063814 AACACAGTGGTGAATAAGTTGGG + Intronic
901305257 1:8228153-8228175 GTCACAGTGGTGAACAAGAGAGG + Intergenic
901366352 1:8753242-8753264 GAGTCATTGGTGAATGGGAATGG - Intronic
901598532 1:10404210-10404232 GAGTCAGTGGTGGAGAGGAAGGG + Exonic
902055839 1:13599744-13599766 GACAGAGAAGTGAATAGGTAAGG - Intronic
903005863 1:20298304-20298326 GTCTCAGTGGTGAATCTGAAAGG + Intronic
904277846 1:29395854-29395876 GGGACAGTGGGGAAGAGGAAGGG - Intergenic
904940309 1:34161401-34161423 CAGAGAGTGGTGAAAAGGAATGG + Intronic
905099401 1:35505578-35505600 GATACAAAGGTGAATAAGAATGG - Intronic
905314359 1:37072129-37072151 GACACAATGGTGAACAAGACGGG - Intergenic
906106222 1:43294158-43294180 GACACAGGGATGATGAGGAAAGG - Intergenic
906236751 1:44216093-44216115 GACACAGTGCTGCATATGACAGG - Intronic
906681356 1:47727845-47727867 GACACAGCGGTTAAAAGCAAAGG - Intergenic
906795621 1:48694221-48694243 GAAACGGTGGTGGGTAGGAAAGG + Intronic
906873827 1:49514248-49514270 AACACTGTGTTGAATAGGAGTGG + Intronic
907057950 1:51389431-51389453 AACACTGTGTTGAATAGGAGTGG - Intronic
907404629 1:54246351-54246373 CACACAGTGGAGAATAGGCCTGG - Intronic
907903869 1:58766445-58766467 GATACAGTGGGGAATAAGATAGG - Intergenic
907997720 1:59649779-59649801 AACACTGTGTTGAATAGGAGTGG + Intronic
908394708 1:63714816-63714838 GGCATAGTGGTGAATAAAAAAGG + Intergenic
908802478 1:67894547-67894569 GAAAAAGTGGTTAATAGGTATGG + Intergenic
908937297 1:69391477-69391499 AACACTATGGTGAATAGGAATGG + Intergenic
908939745 1:69417335-69417357 AACACTATGTTGAATAGGAATGG + Intergenic
910398856 1:86818432-86818454 AACACTGTGTTGAATAGGAGTGG - Intergenic
910816936 1:91300897-91300919 AACACTGTGTTGAATAGGAGTGG - Intronic
910915472 1:92283582-92283604 AACACTGTGTTGAATAGGAGTGG - Intronic
910974834 1:92895616-92895638 AACACTGTGTTGAATAGGAGTGG - Intronic
911120285 1:94289520-94289542 AACACTATGTTGAATAGGAATGG + Intergenic
911938202 1:104008216-104008238 AACACTGTGTTGAATAGGAGTGG + Intergenic
912093812 1:106114787-106114809 AACACTGTGTTGAATAGGAGTGG - Intergenic
912759683 1:112356197-112356219 GAGTCAGTGGTGGATAGGGAAGG - Intergenic
912790640 1:112646232-112646254 AATACAGTGGTGAATAGTAGAGG + Intronic
913117697 1:115712022-115712044 GACACAAGGGTGAATAGGACAGG + Intronic
913323106 1:117604334-117604356 TACACAGTAGTGAAAAAGAATGG + Intergenic
913362777 1:118000850-118000872 GACACTATGTTGAATAGGAGTGG + Intronic
914382201 1:147126852-147126874 AACACTGTGTTGAATAGGAGTGG + Intergenic
914983144 1:152433242-152433264 AACACTGTGTTGAATAGGAGTGG + Intergenic
915124676 1:153655557-153655579 GTGACAGTGTTGAAGAGGAATGG - Intergenic
915618882 1:157066384-157066406 AACACTATGTTGAATAGGAATGG + Intergenic
916014402 1:160736109-160736131 GACACAGTGATGATAAGGTAGGG - Intergenic
916038032 1:160937875-160937897 AACACTGTGTTGAATAGGAGTGG + Intergenic
916250998 1:162738069-162738091 AACACAATGTTGAATAGGAGCGG - Intronic
916393542 1:164359893-164359915 TAAACAGTGGAGAAGAGGAAAGG - Intergenic
916647568 1:166801074-166801096 AACACTGTGTTGAATAGGAGTGG + Intergenic
917723230 1:177806188-177806210 AACACTATGTTGAATAGGAATGG - Intergenic
917921479 1:179754398-179754420 GACACACAGATGAAGAGGAATGG + Intronic
918468046 1:184841967-184841989 GATGCAGGGGTGAATATGAATGG - Intronic
918856178 1:189758902-189758924 AACACTGTGTTGAATAGGAGTGG - Intergenic
918973034 1:191444803-191444825 AACACTATGTTGAATAGGAATGG + Intergenic
919136195 1:193510742-193510764 AACACTGTGTTGAATAGGAGTGG + Intergenic
919344062 1:196351733-196351755 AACACTATGTTGAATAGGAATGG + Intronic
920085846 1:203416081-203416103 AACACTATGTTGAATAGGAATGG - Intergenic
920590246 1:207210850-207210872 AACACTATGGTGAATAGGAGTGG - Intergenic
920645725 1:207802619-207802641 GACACAGTGCTCCATGGGAAAGG + Intergenic
920819667 1:209368533-209368555 GATACAGTGCTTAATAGGAAGGG - Intergenic
921372594 1:214439991-214440013 GACACACTGTGGAATTGGAAGGG - Intronic
921828174 1:219697695-219697717 GCTACAGTGGTGAGGAGGAAGGG + Intronic
922374016 1:224942533-224942555 AACACTGTGTTGAATAGGAGTGG + Intronic
922381091 1:225027282-225027304 AATACAGTGTTGATTAGGAATGG + Intronic
922389778 1:225128779-225128801 AACACTGTGTTGAATAGGAGTGG - Intronic
924130012 1:240897310-240897332 AACACTATGTTGAATAGGAATGG + Intronic
924939108 1:248799192-248799214 AATACAGTGTTGAATAGGAGTGG + Intergenic
1063440866 10:6071917-6071939 GCCACAGTGCTGAGTAGGAGAGG + Intergenic
1063537264 10:6896133-6896155 AGCACAGTGTTGAATAGGAGTGG - Intergenic
1064343993 10:14514060-14514082 AACACTGTGTTGAATAGGAGTGG - Intergenic
1064518277 10:16173596-16173618 AACACTGTGTTGAATAGGAGTGG + Intergenic
1064657714 10:17572488-17572510 CACACTGTGGTCTATAGGAATGG + Intergenic
1064762051 10:18631366-18631388 AACACTGTGTTGAATAGGAGTGG - Intronic
1065050087 10:21783013-21783035 AACACTGTGTTGAATAGGAGTGG - Intronic
1065107501 10:22405165-22405187 AACACAATGTTGAATAGGAGTGG + Intronic
1065123002 10:22546036-22546058 GGCACAGTGGTTAAAAGGACAGG + Intronic
1065237496 10:23668447-23668469 AACACTATGTTGAATAGGAATGG + Intergenic
1065814313 10:29470544-29470566 GACACAGCGGACACTAGGAAGGG - Intronic
1066176825 10:32916273-32916295 AACACTGTGTTGAATAGGAGTGG - Intronic
1066537075 10:36403532-36403554 AACACTGTGTTGAATAGGAGTGG - Intergenic
1067261047 10:44691805-44691827 AACACTGTGTTGAATAGGAGTGG - Intergenic
1067799390 10:49348590-49348612 GACAGAGAGGTGGTTAGGAATGG - Intergenic
1068074602 10:52237281-52237303 AACACTGTGTTGAATAGGAGTGG - Intronic
1068415075 10:56710164-56710186 AACACTGTGTTGAATAGGAGTGG - Intergenic
1068505611 10:57895912-57895934 AACACTATGTTGAATAGGAATGG + Intergenic
1068552251 10:58419805-58419827 AACACTGTGTTGAATAGGAGAGG + Intergenic
1069116251 10:64510378-64510400 GACACAAGGGTAAATAAGAAAGG - Intergenic
1070007534 10:72439513-72439535 AACACTGTGTTGAATAGGAGTGG - Intronic
1070343290 10:75517729-75517751 AACACTGTGTTGAATAGGAGTGG + Intronic
1071244064 10:83743258-83743280 GACACTATGTTGAATAGGAGTGG + Intergenic
1071323391 10:84487769-84487791 AACACTATGTTGAATAGGAATGG + Intronic
1071350023 10:84731322-84731344 AACACTGTGTTGAATAGGAGTGG - Intergenic
1071698112 10:87899851-87899873 AACACTGTGTTGAATAGGAGTGG + Intronic
1071748350 10:88447125-88447147 AACACTGTGTTGAATAGGAATGG - Intronic
1071922547 10:90367828-90367850 AACACTATGTTGAATAGGAAGGG + Intergenic
1072032408 10:91533745-91533767 AACACTGTGTTGAATAGGAGTGG - Intergenic
1072383479 10:94899273-94899295 AACACTGTGTTGAATAGGAGTGG - Intergenic
1072384521 10:94910758-94910780 AACACTATGTTGAATAGGAATGG - Intergenic
1072388435 10:94956936-94956958 AACACTGTGTTGAATAGGAGTGG + Intronic
1072847795 10:98851569-98851591 GACACAGTGGTGAAAAGCCAGGG - Intronic
1072928843 10:99642594-99642616 AACACTGTGTTGAATAGGAGTGG + Intergenic
1073417459 10:103396281-103396303 GAAACGGTGGGGAATGGGAAAGG - Intronic
1073925325 10:108508482-108508504 AACACTGTGTTGAATAGGAGTGG - Intergenic
1073927751 10:108536698-108536720 AACACTGTGTTGAATAGGAGTGG - Intergenic
1073936955 10:108644026-108644048 GACAAAGTGGTGAATGGGGGGGG - Intergenic
1074241221 10:111641191-111641213 AACACTGTGTTGAATAGGAGTGG - Intergenic
1074912268 10:117922094-117922116 GACACAGTGGTGCGTCGGAGAGG - Intergenic
1074964070 10:118473349-118473371 GACACCGTGTTGAGGAGGAAAGG - Intergenic
1076547274 10:131253841-131253863 GCCTCAGTGGTGAATAGATATGG + Intronic
1076894246 10:133302079-133302101 GACAGAGTGGGGAAGAGGGAGGG + Intronic
1077591505 11:3494984-3495006 AACACTGTGTTGAATAGGAGTGG + Intergenic
1077930835 11:6731083-6731105 AACACTGTGTTGAATAGGAGTGG - Intergenic
1078021564 11:7660177-7660199 AACACTGTGTTGAATAGGAGTGG + Intergenic
1078035477 11:7800225-7800247 GATACTGTGTTGAATAGGAGTGG - Intergenic
1078046905 11:7922288-7922310 AACACTATGTTGAATAGGAATGG + Intergenic
1078098398 11:8314119-8314141 GGCACAGTGGGGAATGAGAAAGG - Intergenic
1078115676 11:8447749-8447771 AACACTATGTTGAATAGGAATGG - Intronic
1078552463 11:12290051-12290073 GACACAGTGGGCATCAGGAAGGG + Intronic
1078902572 11:15655046-15655068 GACACAGAGATGAAAAGGCATGG + Intergenic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079448299 11:20576877-20576899 AACACTGTGTTGAATAGGAGTGG - Intergenic
1079539178 11:21551370-21551392 AACACTATGTTGAATAGGAATGG + Intronic
1079632779 11:22697973-22697995 AACACTGTGTTGAATAGGAGTGG + Intronic
1079675246 11:23218717-23218739 AACACTATGTTGAATAGGAATGG - Intergenic
1079981176 11:27153060-27153082 GACTCATTGGTGAATAAGATTGG - Intergenic
1080478979 11:32625942-32625964 AACACTATGTTGAATAGGAACGG - Intronic
1080484759 11:32694027-32694049 AACACTATGTTGAATAGGAATGG - Intronic
1080591520 11:33727635-33727657 AATACTGTGTTGAATAGGAATGG - Intronic
1080610397 11:33899205-33899227 GACACAGGGGTGAATAAGACAGG - Intergenic
1080982910 11:37429923-37429945 AACACTATGTTGAATAGGAATGG + Intergenic
1081313532 11:41603003-41603025 AACACTATGTTGAATAGGAATGG - Intergenic
1081836228 11:46157303-46157325 AACACTGTGTTGAATAGGAGTGG + Intergenic
1082196231 11:49309773-49309795 AACACTATGGTGAATAGGAGCGG + Intergenic
1082311061 11:50649085-50649107 AACACTGTGTTGAATAGGAGTGG + Intergenic
1082317246 11:50745012-50745034 AACACTATGTTGAATAGGAATGG + Intergenic
1082555945 11:54563248-54563270 AACACTGTGTTGAATAGGAGTGG + Intergenic
1083165674 11:60885184-60885206 AACACTGTGTTGAATAGGAGTGG - Intergenic
1083334439 11:61914535-61914557 GAAACTGTGGGGAATCGGAAGGG + Intronic
1083383669 11:62290788-62290810 GACACTATGTTGAATAGGAGTGG - Intergenic
1083509664 11:63196718-63196740 AACACTGTGTTGAATAGGACTGG - Intronic
1083519851 11:63299035-63299057 AACATAGAGGTGAGTAGGAAAGG + Exonic
1083532730 11:63439273-63439295 AACACTATGTTGAATAGGAATGG - Intergenic
1084477841 11:69398948-69398970 GCCACAGTGGGGACCAGGAAGGG + Intergenic
1085130757 11:74036329-74036351 GATACAGTGGTGGATATGACAGG - Intronic
1085135296 11:74082015-74082037 AACACTATGTTGAATAGGAATGG + Intronic
1085221698 11:74879493-74879515 AACACTGTGTTGAATAGGAGTGG + Intronic
1085368483 11:75975895-75975917 AACACTGTGTTGAATAGGAGTGG + Intronic
1085511190 11:77088993-77089015 GACAAAGTGGTGCACAGGATTGG - Intronic
1085816514 11:79742924-79742946 GACACAGTGGTGAGGAGAAGAGG - Intergenic
1085876662 11:80415554-80415576 GGCACAGTTGAGAATCGGAAAGG + Intergenic
1085908413 11:80792357-80792379 AACACGATGTTGAATAGGAATGG + Intergenic
1086271126 11:85068263-85068285 AACACAATGTTGAATAGGAGTGG - Intronic
1086307716 11:85500059-85500081 AACACTGTGTTGAATAGGAGTGG - Intronic
1086523675 11:87700125-87700147 AACACTGTGTTGAATAGGAGTGG + Intergenic
1086659596 11:89398429-89398451 AACACTATGGTGAATAGGAGCGG - Intronic
1086743917 11:90402099-90402121 AACACTGTGTTGAATAGGAGCGG + Intergenic
1087103557 11:94388285-94388307 AACACTGTGTTGAATAGGAGTGG - Intronic
1087143892 11:94792804-94792826 GAAACAGTGGTGAAGGGAAAAGG + Intronic
1087506773 11:99033797-99033819 AACACTATGGTGAATAGGAGTGG + Intronic
1087560706 11:99785967-99785989 AATACAGTGCTGAATAGGAGTGG - Intronic
1087697474 11:101396385-101396407 GATACTATGTTGAATAGGAATGG + Intergenic
1088272668 11:108050882-108050904 AACTCAGTGCTGAATATGAAGGG + Intronic
1088509163 11:110556865-110556887 AACACTGTGTTGAATAGGAGTGG + Intergenic
1088521190 11:110702498-110702520 AACACTATGTTGAATAGGAATGG - Intronic
1088946335 11:114517024-114517046 GACACAGCGCTGAACAGGACAGG - Intergenic
1089102019 11:115971042-115971064 AACACTGTGTTGAATAGGAGTGG - Intergenic
1089963068 11:122633009-122633031 GAAAAAGAAGTGAATAGGAAAGG + Intergenic
1090082999 11:123626782-123626804 AACACAGAGGTGAAGAGGATTGG - Intronic
1090151399 11:124388288-124388310 AACACTGTGTTGAATAGGAGTGG + Intergenic
1090812021 11:130253180-130253202 AACACTGTGTTGAATAGGAGTGG - Intronic
1090964454 11:131585811-131585833 GCCACAGTGGGAAAAAGGAAAGG - Intronic
1091151116 11:133328795-133328817 GACACTATGTTGAATAGGAGAGG - Intronic
1091417511 12:301641-301663 AACACTGTGTTGAATAGGAGTGG - Intronic
1091538118 12:1432752-1432774 GATACAGTGGTGAAGAGCATGGG - Intronic
1091636703 12:2202663-2202685 GCCACAGAGGAGAAGAGGAAGGG + Intronic
1091691949 12:2603296-2603318 GACACAGTGATAGATAGGAATGG + Intronic
1091763502 12:3103465-3103487 GACTCAGTGGTGAATCGGACTGG + Intronic
1092107788 12:5935213-5935235 GATACAGAGGTGAATAAGATAGG - Intronic
1092828541 12:12421078-12421100 AACACTGTGTTGAATAGGAGTGG + Intronic
1093085566 12:14863378-14863400 AACACTGTGTTGATTAGGAATGG + Intronic
1093106861 12:15097380-15097402 AACACTGTGTTGAATAGGAGTGG - Intergenic
1093329408 12:17816556-17816578 AACACTGTGTTGAATAGGAGTGG + Intergenic
1093493572 12:19730712-19730734 AACACTGTGTTGAATAGGAGTGG + Intergenic
1093574668 12:20712883-20712905 GACAAAGAGGAGAATATGAAAGG + Intronic
1093605271 12:21081151-21081173 GGCTCAGTGGGGAAAAGGAATGG + Intronic
1093997938 12:25662472-25662494 AACACTGTGTTGAATAGGAGTGG + Intergenic
1094340709 12:29408336-29408358 AACACTGTGTTGAATAGGAGTGG + Intergenic
1094710803 12:32960281-32960303 AACACTATGTTGAATAGGAATGG - Intergenic
1094728126 12:33143793-33143815 AACACTGTGTTGAATAGGAGTGG + Intergenic
1094745124 12:33335826-33335848 AACACTATGTTGAATAGGAATGG - Intergenic
1095116122 12:38354210-38354232 AACACTGTGTTGAATAGGAGTGG + Intergenic
1095264760 12:40142259-40142281 CACTCAGTTGTGAATAGGAAGGG - Intergenic
1095798847 12:46250450-46250472 AACACTGTGTTGAATAGGAGTGG - Intronic
1095874014 12:47060813-47060835 AACACTGTGTTGAATAGGAGTGG - Intergenic
1095935613 12:47677355-47677377 GACATTGTGTTGAATAGGAGTGG - Intronic
1096236643 12:49932851-49932873 GACACAGTGGTGACTAAGGCAGG - Intergenic
1096360017 12:50976609-50976631 AACACTGTGTTGAATAGGAGTGG - Intergenic
1096426443 12:51507842-51507864 GACAGAGTGGGGAGTAGGAGGGG + Exonic
1097139840 12:56892010-56892032 AACACTGTGTTGAAAAGGAATGG - Intergenic
1097749939 12:63340978-63341000 AACACTGTGTTGAATAGGAGTGG - Intergenic
1098116068 12:67178206-67178228 GAAACAATTGTGAATGGGAATGG - Intergenic
1098421329 12:70301249-70301271 AACACTGTGTTGAATAGGAGTGG + Intronic
1098484527 12:71005276-71005298 AAAACAGTGGTTAACAGGAAAGG - Intergenic
1098506970 12:71264261-71264283 AACACTATGCTGAATAGGAATGG - Intronic
1099107144 12:78510532-78510554 AACACAATGTTGAATAGGAGTGG - Intergenic
1099313608 12:81058367-81058389 AACACTGTGTTGAATAGGAATGG + Intronic
1099320163 12:81136870-81136892 GAAACAGTGGGCAATATGAAGGG + Intronic
1099358075 12:81663151-81663173 CACACTGTGTTGAATAGGAGTGG - Intronic
1099388577 12:82049947-82049969 AACACTATGTTGAATAGGAATGG - Intergenic
1099627077 12:85088969-85088991 AACACTGTGTTGAATAGGAGTGG + Intronic
1099740734 12:86630866-86630888 AACACTATGTTGAATAGGAATGG - Intronic
1100450476 12:94701238-94701260 GACACAGTGGTCAAGAGCACAGG + Intergenic
1101012976 12:100470588-100470610 GACACAGTGGTGAACAAGATAGG + Intergenic
1101100764 12:101390150-101390172 AACACTGTGTTGAATAGGAGTGG - Intergenic
1101284630 12:103298067-103298089 AACACTGTGTTGAATAGGAGTGG - Intronic
1101297410 12:103438369-103438391 AACACTGTGTTGAATAGGAGTGG - Intronic
1101358534 12:104004342-104004364 AACACTGTGTTGAATAGGAGTGG - Intronic
1101466267 12:104953057-104953079 GATTCAGTGGTGAACAAGAATGG - Intronic
1101717560 12:107323780-107323802 GACACAGAGATGAATAAGAATGG - Intronic
1101766705 12:107707425-107707447 AACACTGTGTTGAATAGGAGTGG + Intronic
1101768501 12:107726221-107726243 AACACTGTGTTGAATAGGAGTGG - Intergenic
1102472591 12:113168019-113168041 CACGCAGGGGTGAATTGGAAGGG - Intronic
1102796334 12:115691943-115691965 GACACAGAGGGGGAGAGGAAGGG - Intergenic
1103412841 12:120725078-120725100 GACACAGTACTGAAGTGGAACGG + Intergenic
1103827668 12:123753132-123753154 GACACAGTGGTCACTGGTAAGGG - Intronic
1103827683 12:123753212-123753234 GACACAGTGGTCACTGGTAAGGG - Intronic
1104086652 12:125481218-125481240 AACACTGTGTTGAATAGGAGTGG - Intronic
1104362653 12:128148664-128148686 GACAAAGTGGTGATGAAGAAAGG + Intergenic
1105008789 12:132740515-132740537 GACAGAGTTTTGGATAGGAATGG + Intronic
1105066087 12:133199064-133199086 AACACTGTGTTGAATAGGAGTGG + Intronic
1105073106 12:133249038-133249060 AACACTGTGTTGAATAGGAGTGG - Intergenic
1105269028 13:18853482-18853504 GACACAGCTCTGAATAGCAAGGG - Intergenic
1105350799 13:19613769-19613791 AACACTGTGTTGAATAGGAGTGG + Intergenic
1105732359 13:23230813-23230835 AACACTGTGTTGAATAGGAGTGG + Intronic
1106327829 13:28710813-28710835 GGCACAATAGTGAAAAGGAACGG + Exonic
1106817231 13:33422058-33422080 AACACTGTGTTGAATAGGAATGG - Intergenic
1106991318 13:35424178-35424200 AACACATTGTTGAATAGGAGTGG + Intronic
1107009058 13:35649638-35649660 GAAACACTGTTGAATAGAAAGGG - Exonic
1107592336 13:41921400-41921422 AACACTGTGTTGAATAGGAGTGG - Intronic
1107613749 13:42142925-42142947 AACACTGTGTTGAATAGGAGTGG + Intronic
1107971687 13:45649014-45649036 AACACTGTGTTGAATAGGAGTGG - Intergenic
1108448517 13:50534960-50534982 AATACAGTGTTGAATAGGAGAGG + Intronic
1108473880 13:50794161-50794183 GATACAGTGGTGAATACAAAGGG - Intronic
1108607080 13:52050508-52050530 GAAACAGTGGAGAATAAGAGTGG - Intronic
1108733419 13:53258065-53258087 GAAACAGTGGTCACTAGGCATGG + Intergenic
1108892136 13:55274596-55274618 AACACTTTGGTGAATAGGAGTGG + Intergenic
1108940928 13:55951744-55951766 AATACTATGGTGAATAGGAATGG - Intergenic
1109101085 13:58184169-58184191 AACACTATGTTGAATAGGAATGG + Intergenic
1110970110 13:81751148-81751170 AACACTGTGTTGAATAGGAGTGG - Intergenic
1111217438 13:85163000-85163022 GACACACTGGTGAAAAGGGTGGG + Intergenic
1111434924 13:88193934-88193956 AACACTGTGTTGAATAGGAGTGG + Intergenic
1111786559 13:92794496-92794518 AACACTGTGTTGAATAGGAATGG - Intronic
1112087731 13:96049441-96049463 AACACTGTGTTGAATAGGAGTGG - Intronic
1112411591 13:99168699-99168721 AACACTATGGTGAATAGGAGTGG + Intergenic
1113544320 13:111135824-111135846 AACACTGTGTTGAATAGGAGTGG + Intronic
1114386245 14:22258388-22258410 AACACTATGTTGAATAGGAATGG + Intergenic
1114395262 14:22352981-22353003 AACACTGTGTTGAATAGGAGTGG - Intergenic
1114684915 14:24519518-24519540 AACACTATGTTGAATAGGAATGG + Intergenic
1114800780 14:25773346-25773368 AACACTCTGTTGAATAGGAATGG + Intergenic
1115168657 14:30478011-30478033 AACACTGTGTTGAATAGGAGTGG - Intergenic
1115950371 14:38714416-38714438 AACACTGTGTTGAATAGGAATGG - Intergenic
1115969112 14:38925768-38925790 AACACTGTGTTGAATAGGAGTGG - Intergenic
1116002876 14:39263044-39263066 AACACTGTGTTGAATAGGAGTGG + Intronic
1116011321 14:39355581-39355603 AACACTGTGTTGAATAGGAGTGG + Intronic
1116078307 14:40141593-40141615 AACACTGTGTTGAATAGGAGTGG + Intergenic
1116174610 14:41451346-41451368 TACACAATAGTGAACAGGAAAGG + Intergenic
1116246890 14:42426834-42426856 AACACTGTGTTGAATAGGAGTGG - Intergenic
1116583863 14:46677460-46677482 AACACTATGTTGAATAGGAATGG - Intergenic
1116615967 14:47139476-47139498 GACACAGAGGTCACTAGGCAAGG - Intronic
1116675873 14:47905152-47905174 AACACTATGTTGAATAGGAATGG - Intergenic
1117082022 14:52161802-52161824 AACACTATGTTGAATAGGAATGG - Intergenic
1117436174 14:55717056-55717078 GCCACAGTGGAGAATGGGATTGG - Intergenic
1117627796 14:57657575-57657597 GGCACAGTGGAGAAAAGCAAGGG - Intronic
1118579087 14:67275148-67275170 AACACTGTGTTGAATAGGAGTGG + Intronic
1118583608 14:67329506-67329528 AACACTGTGTTGAATAGGAGTGG + Intronic
1118619061 14:67598174-67598196 TAAACAGTTTTGAATAGGAAAGG + Intronic
1118750546 14:68804900-68804922 AATACAGTGTTGAATAGGCATGG + Intergenic
1119700004 14:76748388-76748410 AACACTGTGTTGAATAGGAGTGG - Intergenic
1120173201 14:81267160-81267182 GAAGCAGAGGTGAGTAGGAACGG + Intronic
1120478565 14:85020405-85020427 AACACTGTGTTGAATAGGAGTGG + Intergenic
1120559281 14:85971065-85971087 AACACTATGTTGAATAGGAATGG + Intergenic
1120776708 14:88445514-88445536 AACACTGTGTTGAATAGGAGTGG + Intronic
1120777904 14:88457755-88457777 AACACTGTGTTGAATAGGAGTGG + Intronic
1122193609 14:100068019-100068041 GACACAGTGGTAAACAAGACAGG + Intronic
1122197962 14:100103670-100103692 TACAAAGTGGTGAATGGCAATGG - Intronic
1122201268 14:100124046-100124068 ACCACAGTGGGGAAGAGGAAGGG + Intronic
1122442992 14:101746252-101746274 AACACTGTGTTGAATAGGAGTGG + Intergenic
1202830274 14_GL000009v2_random:20495-20517 GACACAGCTCTGAATAGCAAGGG + Intergenic
1124094531 15:26636875-26636897 GAAACAGTGGTGATAAGGTATGG - Intronic
1124472019 15:29996103-29996125 TAGACAGTGGAGATTAGGAAGGG + Intergenic
1124668909 15:31619796-31619818 AACACTATGTTGAATAGGAATGG + Intronic
1124935864 15:34170051-34170073 AACACTGTGTTGAATAGGAGTGG - Intronic
1125280241 15:38035103-38035125 GAGACAGAGATGAAAAGGAAAGG + Intergenic
1125522606 15:40356584-40356606 GGCACAGGAGTGAAAAGGAAAGG - Intergenic
1125554319 15:40571716-40571738 GCCACAGGGGTGAACGGGAATGG - Exonic
1126086679 15:45017039-45017061 AACACTATGTTGAATAGGAATGG + Intergenic
1126656762 15:50986336-50986358 AACACTGTGTTGAATAGGAGTGG + Intronic
1128182851 15:65620176-65620198 GATTCAGTGGTGAATAAGACAGG + Intronic
1128853490 15:70986663-70986685 AACACTGTGTTGAATAGGAGTGG + Intronic
1129588333 15:76891282-76891304 AACACTGTGTTGAATAGGAGTGG - Intronic
1129631969 15:77270241-77270263 AACACTGTGTTGAATAGGAGTGG - Intronic
1129768629 15:78187787-78187809 AACACAATGTTGAATAGGAGTGG - Intronic
1129967205 15:79747119-79747141 AACACTATGGTGAATAGGAGTGG + Intergenic
1130452980 15:84076193-84076215 AACACTGTGTTGAATAGGAGTGG - Intergenic
1130642463 15:85691483-85691505 TACACAGTCATGAAGAGGAACGG - Intronic
1131415494 15:92252652-92252674 AACACTATGTTGAATAGGAATGG - Intergenic
1131638109 15:94259323-94259345 GGCAGAGTGGTGATCAGGAAGGG + Intronic
1132139362 15:99378568-99378590 AACACTGTGTTGAATAGGAGTGG + Intronic
1132948188 16:2544372-2544394 GAAACAGTGGTGAATAAGGTAGG + Intronic
1132966258 16:2656755-2656777 GAAACAGTGGTGAATAAGGTAGG - Intergenic
1133404111 16:5509434-5509456 GACACAATTGTGAACAGAAATGG - Intergenic
1134253915 16:12595765-12595787 AACACTGTGTTGAATAGGAGTGG - Intergenic
1134532519 16:14995169-14995191 CACACCGTGTTGAATAGGAGTGG + Intronic
1136695515 16:32077254-32077276 GACACTATGTTGAATAGGAGTGG - Intergenic
1136727394 16:32371428-32371450 AACACTATGTTGAATAGGAATGG - Intergenic
1136796011 16:33020499-33020521 GACACTATGTTGAATAGGAGTGG - Intergenic
1136873910 16:33833899-33833921 GACACTATGTTGAATAGGAGTGG + Intergenic
1137522631 16:49208107-49208129 GACACAGAGGTGAACAGCACAGG + Intergenic
1137846773 16:51697642-51697664 GAAGCACTGGTGAATAGGAAGGG - Intergenic
1138260730 16:55619543-55619565 AACACTGTGTTGAATAGGAGTGG - Intergenic
1138357572 16:56395642-56395664 AACACTGTGTTGAATAGGAGTGG - Intronic
1139213236 16:65101566-65101588 TACAAAGTGGTGAGTAGGGAGGG - Intronic
1139226678 16:65238940-65238962 AACACTGTGTTGAATAGGAGTGG + Intergenic
1139238054 16:65360689-65360711 AACACTGTGTTGAATAGGAGTGG - Intergenic
1139863512 16:70045541-70045563 AACACTGTGTTGAATAGGAGTGG - Intergenic
1140147784 16:72328497-72328519 AACACTGTGTTGAATAGGAGTGG - Intergenic
1140544484 16:75793118-75793140 GACACAATGATGAACAAGAAAGG - Intergenic
1202999039 16_KI270728v1_random:146322-146344 AACACTATGTTGAATAGGAATGG + Intergenic
1203098269 16_KI270728v1_random:1282157-1282179 GACACTATGTTGAATAGGAGTGG - Intergenic
1203130637 16_KI270728v1_random:1682730-1682752 AACACTATGTTGAATAGGAATGG + Intergenic
1142538327 17:636445-636467 AACACTATGTTGAATAGGAATGG + Intronic
1143352733 17:6300558-6300580 GATAGAGTGGTGAATAAGACAGG - Intergenic
1143921925 17:10336899-10336921 GACACAGTGCTCAAGAGGAGGGG - Intronic
1144466455 17:15501471-15501493 GGGACAGTGATGAACAGGAAGGG - Intronic
1145718026 17:27041695-27041717 AACACTGTGTTGAATAGGAGTGG + Intergenic
1145719845 17:27060281-27060303 AACACTGTGTTGAATAGGAGTGG + Intergenic
1145726446 17:27130506-27130528 AACACTGTGTTGAATAGGAGTGG + Intergenic
1145727645 17:27146607-27146629 AACACTGTGTTGAATAGGAGTGG - Intergenic
1147649016 17:42051289-42051311 GACAGAGTGGGGAAGAGGGAGGG + Intronic
1148407420 17:47429412-47429434 GGCACAGTGGTTAAGAGGATGGG + Intronic
1149240505 17:54643310-54643332 GACACTATGTTGAATAGGAGTGG - Intergenic
1149255774 17:54824777-54824799 AACACTATGTTGAATAGGAATGG - Intergenic
1150517869 17:65833318-65833340 AATACAGTGGTGAATAGGAGTGG - Intronic
1150587455 17:66531710-66531732 GACACAGGTGTGAAAAGGAATGG - Intronic
1151231015 17:72685139-72685161 GACACAGGGGTGAATGAGACAGG + Intronic
1151286621 17:73116599-73116621 GACACAGTGGGCAACAGGGATGG + Intergenic
1151472923 17:74328985-74329007 GAAACTGTGGTGAACAGAAAAGG + Intronic
1151527633 17:74681770-74681792 GAACCAGTGGTGAACAGGACAGG - Intronic
1151999424 17:77636253-77636275 GACCCAGTGGTGATGGGGAAGGG + Intergenic
1203160894 17_GL000205v2_random:48549-48571 AACACTGTGTTGAATAGGAGTGG - Intergenic
1153658970 18:7309615-7309637 GACACAGTGGTTCCTAGGAAGGG + Intergenic
1153857746 18:9167746-9167768 AACACTGTGTTGAATAGGAGTGG + Intronic
1153858921 18:9179298-9179320 AGTACAGTGTTGAATAGGAATGG + Intronic
1154184350 18:12169162-12169184 AACACTATGTTGAATAGGAATGG + Intergenic
1154419002 18:14206507-14206529 GACACAGCTCTGAATAGCAAGGG + Intergenic
1155560013 18:27065524-27065546 GAGAGAGTGGAGAAAAGGAAAGG + Intronic
1155660630 18:28244412-28244434 AACACTGTGTTGAATAGGAGTGG - Intergenic
1155674930 18:28418570-28418592 AACACTGTGTTGAATAGGAGTGG + Intergenic
1155956984 18:31962557-31962579 GAGTCAGTGGTGGAGAGGAAGGG + Intergenic
1156002355 18:32399284-32399306 AACACTGTGTTGAATAGGAGTGG - Intronic
1156427204 18:37026836-37026858 AACACTGTGTTGAATAGGAGTGG - Intronic
1156532224 18:37828794-37828816 AACACAGTGTTGAATAGGAGTGG + Intergenic
1156632419 18:38985709-38985731 GACACAGTGATGCAAAGGATGGG - Intergenic
1157071456 18:44413507-44413529 AACACAGTGTTGAATAGGAGTGG - Intergenic
1157123066 18:44929964-44929986 AACACTGTGTTGAATAGGAGTGG + Intronic
1157127717 18:44972905-44972927 AACACTGTGTTGAATAGGAGTGG + Intronic
1157183305 18:45517048-45517070 GACACAGAGGTGAATGAGACTGG + Intronic
1157305122 18:46511437-46511459 GAGGCAGTGGTGTCTAGGAAGGG + Intronic
1157489781 18:48114732-48114754 TATTCAGTGGTGAAAAGGAATGG + Intronic
1157635180 18:49146307-49146329 AACACTGTGTTGAATAGGAGTGG - Intronic
1158114110 18:53975789-53975811 AACACTGTGTTGAATAGGAGTGG + Intergenic
1159117732 18:64135057-64135079 CCCACAGTGGTCAAAAGGAACGG - Intergenic
1159227346 18:65556433-65556455 AACACAATGTTGAATAGGAGTGG + Intergenic
1159281861 18:66295916-66295938 AACACTGTGTTGAATAGGAGTGG - Intergenic
1164029579 19:21390362-21390384 GACAAAGTGGAGAATCAGAATGG + Intergenic
1164405884 19:27945721-27945743 AACACTGTGTTGAATAGGAATGG + Intergenic
1164499614 19:28806742-28806764 AACACTGTGTTGAATAGGAGTGG - Intergenic
1164600119 19:29556496-29556518 AACACTATGGTGAATAGGAGTGG - Intronic
1164971114 19:32533290-32533312 AAAACAGTGGTGAATGGCAAAGG - Intergenic
1165011405 19:32850144-32850166 AACACTATGTTGAATAGGAATGG - Intronic
1165265436 19:34659252-34659274 AACACTGTGTTGAATAGGAGTGG - Intronic
1167256871 19:48435805-48435827 GATACAGTGGTGAATCAGACGGG + Intronic
1202642416 1_KI270706v1_random:107277-107299 GACACAGCTCTGAATAGCAAGGG - Intergenic
1202706998 1_KI270713v1_random:31461-31483 GACACGGAGATAAATAGGAACGG + Intergenic
925334665 2:3086474-3086496 AACACTATGGTGAATAGGAGTGG - Intergenic
925884522 2:8383124-8383146 GATACAAAGGTGAATAGGACAGG + Intergenic
925956525 2:8971479-8971501 AACACTGTGTTGAATAGGAGTGG - Intronic
926239999 2:11078144-11078166 GACACAGAGTTGAAGAGGACAGG + Intergenic
926454233 2:13044420-13044442 AACACTGTGTTGAATAGGAATGG - Intergenic
926535298 2:14103246-14103268 AACACTGTGTTGAATAGGAGTGG - Intergenic
926844978 2:17126451-17126473 GACAGAATGGTGATAAGGAAGGG - Intergenic
927651853 2:24918149-24918171 GGCACAGGGGTGAAAAGGCAGGG + Intronic
927733621 2:25498503-25498525 GACACAGTGCAGAATGTGAAGGG + Intronic
928576594 2:32661796-32661818 AACACTATGTTGAATAGGAATGG + Intronic
928631651 2:33199587-33199609 AACACTATGTTGAATAGGAATGG - Intronic
928927278 2:36592925-36592947 AACAGAGAGGAGAATAGGAATGG - Intronic
929276044 2:40025931-40025953 AACACTATGTTGAATAGGAATGG - Intergenic
929395264 2:41515115-41515137 AACACTGTGTTGAATAGGAGTGG + Intergenic
929566893 2:42993452-42993474 AACACTGTGTTGAATAGGAGCGG - Intergenic
930137018 2:47912597-47912619 AACACTGTGTTGAATAGGAGTGG + Intergenic
930245146 2:48976014-48976036 AACACTGTGTTGAATAGGAGTGG + Intronic
930324415 2:49897380-49897402 TACATAGTGGTTAATAGGAGAGG - Intergenic
930838293 2:55818104-55818126 AACACTGTGTTGAATAGGAGTGG - Intergenic
930870291 2:56163823-56163845 AACACTGTGTTGAATAGGAGTGG + Intergenic
930961960 2:57272879-57272901 AACACTATGTTGAATAGGAATGG + Intergenic
931031387 2:58178694-58178716 AATACAGTGTTGAATAGGAGTGG - Intronic
931037824 2:58263046-58263068 AACACTATGTTGAATAGGAATGG - Intergenic
931666513 2:64613026-64613048 GGAACAGAGGTGAAGAGGAAGGG + Intergenic
931827672 2:66018397-66018419 GATAGAGTGGTGGATAGGACAGG + Intergenic
931930054 2:67121819-67121841 AACACTGTGTTGAATAGGAGTGG + Intergenic
932477736 2:72017975-72017997 AACACTGTGTTGAATAGGAGTGG + Intergenic
932517592 2:72368977-72368999 AACACTGTGTTGAATAGGAGTGG - Intronic
932649750 2:73542476-73542498 AACACTGTGTTGAATAGGAGTGG - Intronic
932662320 2:73666527-73666549 AACACTGTGTTGAATAGGAGTGG + Intergenic
933050586 2:77596794-77596816 AACACTGTGTTGAATAGGAGTGG - Intergenic
933283997 2:80364773-80364795 GACACAGAGGTGATTATAAAAGG - Intronic
933971904 2:87476756-87476778 GACACAGAGGTGAACTAGAAAGG + Intergenic
934498251 2:94830717-94830739 GACACAGCTCTGAATAGCAAGGG - Intergenic
934999028 2:98993168-98993190 AACACTGTGTTGAATAGGAGTGG - Intergenic
935001774 2:99024676-99024698 GCTACAGTGTTGAATAGAAAAGG + Intronic
935095523 2:99940840-99940862 GACACTGTTGTTAACAGGAAAGG - Intronic
935822995 2:106913275-106913297 AACACAATGTTGAATAGGAGTGG - Intergenic
936321822 2:111473444-111473466 GACACAGAGGTGAACTAGAAAGG - Intergenic
936774979 2:115962057-115962079 AACACTGTGTTGAATAGGAGTGG + Intergenic
936806068 2:116333809-116333831 AACACTGTGTTGAATAGGAGTGG + Intergenic
936873392 2:117160000-117160022 AACACTGTGTTGAATAGGAGTGG - Intergenic
936876856 2:117200565-117200587 GACACAGAGGGAAATAGGTAAGG - Intergenic
937388882 2:121465132-121465154 AACACTGTGTTGAATAGGAGTGG - Intronic
937484813 2:122304304-122304326 AATACAATGTTGAATAGGAATGG - Intergenic
937700490 2:124858167-124858189 AACACTGTGTTGAATAGGAGTGG - Intronic
938147913 2:128853051-128853073 AACACTATGTTGAATAGGAATGG - Intergenic
938402216 2:131003295-131003317 GAAACAGTGTGGAACAGGAATGG - Intronic
938633014 2:133189886-133189908 AACACTGTGTTGAATAGGAGTGG - Intronic
938871578 2:135482645-135482667 AACACTATGTTGAATAGGAATGG + Intronic
938915984 2:135940622-135940644 AACACTGTGTTGAATAGGAGTGG - Intronic
939019580 2:136942879-136942901 AACACTGTGTTGAATAGGAGTGG + Intronic
939030731 2:137072632-137072654 AACACTGTGTTGAATAGGAGTGG + Intronic
939942447 2:148366439-148366461 AACACTATGTTGAATAGGAATGG - Intronic
940340901 2:152579749-152579771 TACAAGGTGGTGAATATGAAAGG - Intronic
940679944 2:156773402-156773424 AACACTGTGTTGAATAGGAGTGG + Intergenic
940758328 2:157708590-157708612 AACACTGTGTTGAATAGGAGTGG - Intergenic
941337600 2:164265100-164265122 AACACTGTGTTGAATAGGAGTGG - Intergenic
941776912 2:169403247-169403269 AACACTATGTTGAATAGGAATGG - Intergenic
941829976 2:169945309-169945331 GGCACAGTGGTGAAGAGCATAGG - Intronic
941981029 2:171457008-171457030 AACACACTGTTGAATAGGAATGG + Intronic
942196822 2:173529320-173529342 AACACTGTGTTGAATAGGAGTGG + Intergenic
942410248 2:175702065-175702087 GACACTATGTTGAATAGGAGTGG + Intergenic
942790342 2:179753961-179753983 AACACTGTGTTGAATAGGAGTGG + Intronic
943011360 2:182453880-182453902 AACACTGTGTTGAATAGGAGTGG - Intronic
943020055 2:182562085-182562107 AACACTGTGTTGAATAGGAGTGG + Intergenic
943054535 2:182959700-182959722 AACACTGTGTTGAATAGGAGTGG - Intronic
943178066 2:184503732-184503754 AACACTGTGTTGAATAGGAGTGG - Intergenic
943310330 2:186316878-186316900 AACACTGTGTTGAATAGGAGTGG - Intergenic
943711161 2:191096732-191096754 AACACTGTGTTGAATAGGAGTGG - Intronic
943873656 2:193034536-193034558 AACACTGTGTTGAATAGGAGTGG + Intergenic
943999115 2:194809990-194810012 AACACTATGTTGAATAGGAATGG - Intergenic
944163298 2:196689774-196689796 AACACTATGTTGAATAGGAATGG + Intronic
944197151 2:197066402-197066424 AACACTGTGTTGAATAGGAGTGG - Intronic
944952583 2:204769030-204769052 AACACTGTGTTGAATAGGAGCGG + Intronic
945151072 2:206792621-206792643 GATATAGTGATGAATAGGCATGG + Intergenic
945515768 2:210761960-210761982 AACACTGTGTTGAATAGGAGTGG - Intergenic
945788467 2:214274323-214274345 AACACTGTGTTGAATAGGAGTGG + Intronic
947814416 2:233026436-233026458 GAGACAGTGGTGACTGGGAGGGG - Intergenic
948371180 2:237489928-237489950 GACACAGGGATTAATAGGCAGGG - Intronic
948379975 2:237544420-237544442 GGGACAGTGGTGAATGGGCACGG + Intronic
948498719 2:238374159-238374181 AACACTGTGTTGAATAGGAGTGG + Intronic
948682695 2:239646727-239646749 ACCACAGTGGAGAGTAGGAATGG - Intergenic
1170660748 20:18337036-18337058 AACACTGTGTTGAATAGGAGTGG - Intergenic
1171264313 20:23758502-23758524 AACACTGTGTTGAATAGGAGTGG - Intergenic
1171273989 20:23839579-23839601 AACACTGTGTTGAATAGGAGTGG - Intergenic
1171575156 20:26303111-26303133 AACACTGTGTTGAATAGGAGTGG + Intergenic
1171889517 20:30697460-30697482 GACACAGCTCTGAATAGCAAGGG - Intergenic
1172027929 20:31962068-31962090 GATACAGTGGTGAACAAGATAGG + Intergenic
1173294401 20:41743210-41743232 AATACAGTGTTGAATAGGAGTGG + Intergenic
1173347039 20:42210260-42210282 AACACTGTGTTGAATAGGAGTGG - Intronic
1174657374 20:52182861-52182883 GATCCAGTGGTGAACAGGAGAGG + Intronic
1174694910 20:52547359-52547381 AACACTATGTTGAATAGGAATGG - Intergenic
1174929644 20:54798910-54798932 AATACTGTGTTGAATAGGAATGG - Intergenic
1175046123 20:56107136-56107158 AACACTGTGTTGAATAGGAGTGG + Intergenic
1175341673 20:58234884-58234906 GACACAGACCTGTATAGGAAAGG + Intergenic
1175408766 20:58752427-58752449 GACACAGTCGTGAGTAGCCATGG - Intergenic
1175993644 20:62802406-62802428 GACCCAGGGGTGACTGGGAAAGG + Intergenic
1176941505 21:14931060-14931082 AACACTGTGTTGAATAGGAGTGG - Intergenic
1177241598 21:18465373-18465395 AACACTGTGTTGAATAGGAGTGG - Intronic
1178958715 21:37044873-37044895 GACATAGTGGTGAATAGGGCAGG + Intergenic
1178967968 21:37142213-37142235 GACACTATGTTGAATAGGAGTGG - Intronic
1180359557 22:11875179-11875201 GACACAGCTCTGAATAGCAAGGG + Intergenic
1180724368 22:17934570-17934592 AACACTGTGTTGAATAGGAGTGG - Intronic
1181052169 22:20243123-20243145 GACAGAGTGGTTAGCAGGAAGGG + Intronic
1181326542 22:22053308-22053330 AACACTGTGTTGAATAGGAGAGG + Intergenic
1181959017 22:26609702-26609724 GACGCATGGGTGAATAAGAAGGG + Intronic
1182165384 22:28167783-28167805 AACACTGTGTTGAATAGGAGTGG - Intronic
1182167953 22:28195398-28195420 AACACTATGTTGAATAGGAATGG - Intronic
1182169558 22:28213241-28213263 AACACTATGTTGAATAGGAATGG - Intronic
1182404655 22:30115620-30115642 AACACAGGGGTGAATGGGATAGG + Intronic
1182790100 22:32944656-32944678 AACACTGTGTTGAATAGGAGTGG - Intronic
1182844221 22:33417345-33417367 AACACACTGGTGATTAGAAATGG - Intronic
1183563746 22:38597681-38597703 ATCACAGCGGTGAATAGGAAGGG + Intronic
1184038142 22:41928248-41928270 GACACAGAGGTGAGCAGGAGAGG - Intergenic
949346203 3:3079115-3079137 GCCACAGTGGAAAATAGCAAAGG - Intronic
949664262 3:6318868-6318890 AACACTGTGTTGAATAGGAGTGG - Intergenic
949666481 3:6344910-6344932 AACACTGTGTTGAATAGGAGTGG - Intergenic
949747694 3:7313509-7313531 TATACAGAGGTGAATAAGAAAGG - Intronic
949790131 3:7783648-7783670 AACACTGTGTTGAATAGGAGTGG - Intergenic
949804372 3:7938372-7938394 AACACTGTGTTGAATAGGACTGG - Intergenic
951194838 3:19812591-19812613 GAAATAGTGGGGAGTAGGAAGGG + Intergenic
951452569 3:22855642-22855664 AACACTATGTTGAATAGGAATGG + Intergenic
952074074 3:29674366-29674388 GACACTATGTTGAATAGGAGTGG - Intronic
952099805 3:29997881-29997903 AACACAATGTTGAATAGGAGTGG - Intronic
953080936 3:39617023-39617045 AACACTATGTTGAATAGGAATGG + Intergenic
953097679 3:39794883-39794905 AACACAGTGATGAAAAAGAATGG - Intergenic
953525101 3:43683043-43683065 AACACTGTGTTGAATAGGAGTGG - Intronic
954478094 3:50768144-50768166 AACACTGTGTTGAATAGGAGTGG + Intronic
954478594 3:50774712-50774734 CATACAGTGTTGAATAGAAATGG + Intronic
955221332 3:57025785-57025807 GATACATTGGTGAGTAGGACAGG - Intronic
955650479 3:61189045-61189067 AACACTGTGTTGAATAGGAGTGG - Intronic
955670541 3:61397369-61397391 AACACTGTGTTGAATAGGAGTGG - Intergenic
955886388 3:63603372-63603394 CACACAATGTTGAATAGGAGTGG + Intronic
956105828 3:65817720-65817742 GACATAGAGCAGAATAGGAATGG - Intronic
956153848 3:66272821-66272843 AACACTGTGTTGAATAGGAGTGG + Intronic
956301540 3:67777638-67777660 AATACTGTGGTGAATAGGAATGG + Intergenic
956569452 3:70677702-70677724 AACACTATGTTGAATAGGAATGG + Intergenic
956862097 3:73334877-73334899 AACACTATGTTGAATAGGAATGG + Intergenic
957021950 3:75137510-75137532 GCCACAGTGGTTAAGAGGACAGG + Intergenic
957070716 3:75565765-75565787 AGCACAGTTGTCAATAGGAAAGG - Intergenic
957565778 3:81882227-81882249 AACACTGTGTTGAATAGGAGTGG - Intergenic
957644735 3:82906469-82906491 AACACTATGTTGAATAGGAATGG + Intergenic
958027870 3:88070524-88070546 GCCACAGTGGCGTATAGCAAAGG - Intronic
958038793 3:88201414-88201436 GAAAGAGTGATAAATAGGAAGGG - Intergenic
958725985 3:97906774-97906796 AACACTGTGTTGAATAGGAGTGG + Intronic
958848212 3:99290627-99290649 AACACTATGCTGAATAGGAAGGG + Intergenic
959044028 3:101451825-101451847 AACACAATGTTGAATAGGAGTGG - Intronic
959056420 3:101572163-101572185 GAAACAGTGGTGAACAAGACAGG + Intergenic
959522666 3:107337816-107337838 AACACTATGTTGAATAGGAATGG - Intergenic
959556493 3:107725437-107725459 AACACTATGTTGAATAGGAATGG + Intronic
959713369 3:109406995-109407017 AACACTGTGTTGAATAGGAGTGG + Intergenic
959949366 3:112162299-112162321 AACACTGTGTTGAATAGGAGTGG + Intronic
959953166 3:112205014-112205036 AACACTATGTTGAATAGGAATGG - Intronic
959954087 3:112215321-112215343 AACACTATGTTGAATAGGAATGG - Intronic
960003857 3:112762015-112762037 AAGACAGTGGTGAACAGAAAAGG + Intronic
960069417 3:113412126-113412148 AACACTGTGTTGAATAGGAGTGG - Intronic
960278558 3:115754999-115755021 AACACTATGGTGAATAGGAGTGG - Intergenic
960401777 3:117209055-117209077 AACACAATGTTGAATAGGAGTGG - Intergenic
961915790 3:130373217-130373239 GACACAGTGGTTAAGAGGTTAGG + Intronic
962072979 3:132050882-132050904 AACACTGTGTTGAATAGGAGTGG + Intronic
962125336 3:132611336-132611358 AACACTGTGTTGAATAGGAGTGG - Intronic
962467393 3:135673362-135673384 GACACAGTGGGGATGAGGAGAGG + Intergenic
962641937 3:137396628-137396650 AACACTATGGTGAATAGGAGTGG - Intergenic
962854797 3:139334727-139334749 AACACTGTGTTGAATAGGAGTGG - Intronic
962913731 3:139879460-139879482 AACACAATGTTGAATAGGAGTGG + Intergenic
963514898 3:146296597-146296619 GACATAGAGGTCAATGGGAAAGG - Intergenic
963910973 3:150818093-150818115 AACACTGTGTTGAATAGGAGTGG + Intergenic
964228562 3:154435609-154435631 AACACTATGTTGAATAGGAATGG + Intergenic
964564819 3:158038242-158038264 AACACTATGTTGAATAGGAATGG - Intergenic
964602091 3:158513144-158513166 AACACTGTGTTGAATAGGAGTGG + Intronic
964783118 3:160362980-160363002 AACACTATGTTGAATAGGAATGG - Intronic
966536669 3:181042780-181042802 AACACTGTGTTGAATAGGAGTGG + Intergenic
966813812 3:183872310-183872332 GACTCAGTGTTGAAGAGAAAGGG - Intronic
966862771 3:184239739-184239761 GGCACAGCCGTGAATAAGAAGGG - Exonic
966970007 3:185035721-185035743 AATACAGTGTTGAATAGGAGTGG - Intronic
967260027 3:187633062-187633084 GAAACAGTGATGAATAGGTTGGG - Intergenic
967514186 3:190347572-190347594 GACACAGTTGTGAATAAGATAGG + Intronic
967569539 3:191012572-191012594 AACACTGTGTTGAATAGGAGTGG + Intergenic
967607715 3:191467498-191467520 AACACCGTGTTGAATAGGAGTGG - Intergenic
1202736141 3_GL000221v1_random:102-124 GACACAGCTCTGAATAGCAAGGG + Intergenic
969798808 4:9546524-9546546 AGCACAGTTGTCAATAGGAAAGG + Intergenic
970175420 4:13334607-13334629 AACACTATGTTGAATAGGAATGG + Intergenic
970780542 4:19732695-19732717 AACACTGTGTTGAATAGGAGTGG + Intergenic
970910281 4:21267377-21267399 GACACTATGTTGAATAGGAGTGG + Intronic
970917830 4:21356283-21356305 AATACTGTGTTGAATAGGAATGG - Intronic
970925294 4:21444738-21444760 AACACTGTGTTGAATAGGAGTGG - Intronic
971328476 4:25663419-25663441 GATACAGTGATGAACAGAAAAGG + Intronic
971360560 4:25934414-25934436 GATACAGTGGTGCACAGGACAGG - Intergenic
971517020 4:27499916-27499938 AATACAATGTTGAATAGGAATGG - Intergenic
971803461 4:31322866-31322888 AACACAGTGTTGAATAGAAGAGG - Intergenic
972030069 4:34444249-34444271 AACACTGTGTTGAATAGGAGTGG + Intergenic
972130806 4:35831149-35831171 AACACTGTGTTGAATAGGAGTGG + Intergenic
972212726 4:36858342-36858364 AACACTGTGTTGAATAGGAGTGG - Intergenic
972859679 4:43152129-43152151 GACACTATGTTGAATAGGAGTGG - Intergenic
973066896 4:45806578-45806600 AACACTGTGTTGAATAGGAGTGG - Intergenic
973116433 4:46465821-46465843 AACACTGTGTTGAATAGGAGTGG + Intronic
973341478 4:49009504-49009526 AACACTGTGTTGAATAGGAGTGG + Intronic
973529975 4:51826937-51826959 AATACTGTGTTGAATAGGAATGG + Intergenic
973574835 4:52276470-52276492 AACACTGTGTTGAATAGGAGTGG + Intergenic
973654689 4:53034436-53034458 AACACTGTGTTGAATAGGAGTGG - Intronic
973674620 4:53251846-53251868 AACACTGTGTTGAATAGGAGTGG - Intronic
974119463 4:57621364-57621386 AACACTATGTTGAATAGGAATGG + Intergenic
974427195 4:61756648-61756670 AACACTGTGTTGAATAGGAGTGG + Intronic
974689244 4:65273639-65273661 AACACTATGTTGAATAGGAATGG + Intergenic
974735705 4:65928830-65928852 AACACTGTGTTGAATAGGAGTGG - Intergenic
974947575 4:68546538-68546560 AACACTGTGTTGAATAGGAGTGG - Intronic
974997216 4:69176194-69176216 AACACAATGTTGAATAGGAGTGG - Intronic
975007836 4:69312620-69312642 AACACAATGTTGAATAGGAGTGG + Intronic
975308945 4:72880801-72880823 AACACTGTGTTGAATAGGAGTGG + Intergenic
975744274 4:77460628-77460650 AACACTGTGTTGAATAGGAGAGG + Intergenic
975923420 4:79420346-79420368 AGCACTGTGTTGAATAGGAATGG + Intergenic
976083789 4:81386560-81386582 AACACTGTGTTGAATAGGAGTGG - Intergenic
976432811 4:84982707-84982729 AACACTGTGTTGAATAGGAGTGG + Intergenic
976682537 4:87773183-87773205 AACACTATGTTGAATAGGAATGG - Intergenic
977218463 4:94311165-94311187 AACACTGTGTTGAATAGGAGTGG + Intronic
977364353 4:96048322-96048344 GACACAGGGATGAAGATGAAGGG + Intergenic
977633857 4:99272896-99272918 GACACAGGGCTGAAGAGGACAGG - Intergenic
977815308 4:101407694-101407716 AACACTATGTTGAATAGGAATGG + Intergenic
977925835 4:102699386-102699408 AACACTATGTTGAATAGGAATGG + Intronic
978022241 4:103828469-103828491 AACACTGTGTTGAATAGGAGTGG + Intergenic
978336606 4:107676146-107676168 AACACTGTGTTGAATAGGAGTGG - Intronic
978517436 4:109583591-109583613 AACACTGTGTTGAATAGGAGTGG + Intronic
978520345 4:109609114-109609136 GACACAGTTGTTACTGGGAAGGG + Intronic
978685694 4:111439908-111439930 AACACTGTGTTGAATAGGAGTGG + Intergenic
978858953 4:113426543-113426565 AACACTGTGTTGAATAGGAGTGG + Intergenic
978911375 4:114067979-114068001 AACACTATGATGAATAGGAATGG - Intergenic
978940876 4:114434794-114434816 GGCACAGTGGGGAGGAGGAATGG + Intergenic
978991636 4:115089461-115089483 GAGACAGGCATGAATAGGAAAGG - Intronic
979017093 4:115448655-115448677 AACGCTGTGTTGAATAGGAATGG + Intergenic
979097322 4:116567157-116567179 AATACAATGGTGAATAGGATTGG - Intergenic
979176353 4:117668678-117668700 AACACTATGTTGAATAGGAATGG + Intergenic
979177479 4:117682177-117682199 AACACTATGCTGAATAGGAATGG + Intergenic
979345097 4:119577799-119577821 AACACTGTGTTGAATAGGAGTGG - Intronic
979589457 4:122461877-122461899 AACACTGTGTTGAATAGGAGTGG + Intergenic
979757965 4:124365343-124365365 AACACTGTGTTGAATAGGAGTGG - Intergenic
979850938 4:125570655-125570677 AACACCGTGTTGAATAGGAGTGG + Intergenic
980334653 4:131455879-131455901 AACACTGTGTTGAATAGGAGTGG + Intergenic
981415353 4:144486543-144486565 AACACCATGTTGAATAGGAATGG - Intergenic
981729631 4:147883999-147884021 GGCACAGTGGTTAAGAGGTAGGG - Intronic
981741042 4:148001942-148001964 AACACTGTGTTGAATAGGAGTGG + Intronic
981795893 4:148594997-148595019 AACACTGTGTTGAATAGGAGTGG + Intergenic
982241875 4:153308145-153308167 GACGCTGGGGTGAAGAGGAAAGG - Intronic
982690878 4:158546479-158546501 AACACTATGTTGAATAGGAATGG + Intronic
982718193 4:158830817-158830839 GACACAATGATGAACAGGACAGG - Intronic
982838474 4:160153200-160153222 AACACTGTGTTGAATAGGAGTGG + Intergenic
982880335 4:160706008-160706030 AACACTGTGTTGAATAGGAGTGG + Intergenic
983108588 4:163721057-163721079 AACACTGTGTTGAATAGGAGTGG + Intronic
983464335 4:168068371-168068393 AACACTGTGTTGAATAGGAGTGG - Intergenic
983518381 4:168679920-168679942 GACACAGAAATAAATAGGAAGGG + Intronic
983691296 4:170472477-170472499 AACACTGTGTTGAATAGGAGTGG + Intergenic
983828700 4:172298382-172298404 AACACTATGGTGAATAGGAGTGG + Intronic
983951260 4:173645047-173645069 AACTCTGTGTTGAATAGGAAAGG + Intergenic
984456655 4:179977659-179977681 GACAGAGTGCTGAAGGGGAAGGG - Intergenic
984592212 4:181629365-181629387 GACACTGTGTTGAATAGGAGTGG + Intergenic
984751361 4:183279007-183279029 AACACTGTGTTGAATAGGAGTGG + Intronic
1202769782 4_GL000008v2_random:193175-193197 GACACAGCTCTGAATAGCAAGGG - Intergenic
986277568 5:6291697-6291719 AGCACAATGTTGAATAGGAATGG - Intergenic
986498909 5:8377533-8377555 GACACTATGTTGAATAGGAGTGG - Intergenic
986555301 5:9004502-9004524 AACACTGTGTTGAATAGGAGTGG + Intergenic
986665108 5:10095419-10095441 GATACTATGTTGAATAGGAATGG - Intergenic
987262837 5:16221065-16221087 TAGACAGTGGAGACTAGGAAGGG + Intergenic
987949453 5:24656754-24656776 AACACTGTGTTGAATAGGAGTGG + Intergenic
988528685 5:32008681-32008703 GACACAGCAGTGAATGGAAATGG + Intronic
988811173 5:34786618-34786640 ATCCCAGTGGTGAGTAGGAAGGG - Intronic
989044442 5:37260812-37260834 GACACTATGTTGAATAGGAGTGG + Intergenic
989064485 5:37445902-37445924 GACACTATGTTGAATAGGAGTGG - Intronic
989248206 5:39277764-39277786 AACACTATGTTGAATAGGAATGG + Intergenic
989551297 5:42738696-42738718 AACACTGTGTTGAATAGGAGCGG - Intergenic
989562377 5:42866910-42866932 AACACTGTGTTGAATAGGAGTGG - Intronic
989683864 5:44061918-44061940 AACACTATGTTGAATAGGAATGG + Intergenic
990071387 5:51787174-51787196 GACACTATGTTGAATAGGAGTGG + Intergenic
990655015 5:57945379-57945401 AACACTATGTTGAATAGGAATGG + Intergenic
990695318 5:58409783-58409805 GACAGTGTGGTGAAGAAGAAGGG - Intergenic
990746122 5:58960765-58960787 GGCACAGTGGTCAGTAGGATAGG + Intergenic
990984469 5:61628345-61628367 AATACAATGTTGAATAGGAATGG - Intergenic
991211189 5:64106624-64106646 AACACTGTGTTGAATAGGAGTGG + Intergenic
991639456 5:68738615-68738637 GACCCAGTGGGGAAGTGGAAAGG - Intergenic
992032081 5:72731702-72731724 AACACTATGTTGAATAGGAATGG - Intergenic
992340738 5:75820758-75820780 AACACTATGTTGAATAGGAATGG - Intergenic
992700042 5:79332854-79332876 GACACAGTGGTTAAGAGCAAGGG + Intergenic
992972934 5:82081387-82081409 AACACTGTGTTGAATAGGAGTGG + Intronic
993093847 5:83459831-83459853 AACACTATGTTGAATAGGAATGG + Intergenic
993122701 5:83795641-83795663 AACACTATGTTGAATAGGAATGG + Intergenic
993244638 5:85435544-85435566 AACACTGTGTTGAATAGGAGTGG - Intergenic
993576815 5:89612260-89612282 AACACTGTGTTGAATAGGAGTGG + Intergenic
993949258 5:94153531-94153553 GACACAATTGTGGATAGTAAAGG + Intronic
994545993 5:101166956-101166978 AACACTATGTTGAATAGGAATGG - Intergenic
994624648 5:102203372-102203394 AATACTGTGTTGAATAGGAATGG - Intergenic
994826646 5:104721189-104721211 AACACTGTGTTGAATAGGAGTGG - Intergenic
995178796 5:109210523-109210545 AACACTATGTTGAATAGGAATGG + Intergenic
995450416 5:112293885-112293907 TAAACAGTGTTTAATAGGAAAGG - Intronic
995529532 5:113078771-113078793 AACACTGTGTTGAATAGGAGTGG - Intronic
995665062 5:114532677-114532699 AACACTGTGTTGAATAGGAGTGG + Intergenic
995692366 5:114841902-114841924 AACACTATGTTGAATAGGAATGG - Intergenic
996539040 5:124609757-124609779 AACACTGTGTTGAATAGGAGTGG - Intergenic
996673794 5:126151827-126151849 AACACTGTGTTGAATAGGAGTGG + Intergenic
997771294 5:136556716-136556738 GGCACAGCAGTGACTAGGAAGGG + Intergenic
998774464 5:145583403-145583425 AACACTATGTTGAATAGGAATGG - Intronic
999604562 5:153300256-153300278 GAAACAAAGGTGAATAGGAGAGG + Intergenic
999867409 5:155715967-155715989 AACACTATGTTGAATAGGAATGG + Intergenic
1000273908 5:159715524-159715546 AACACTATGTTGAATAGGAATGG + Intergenic
1000308433 5:160017902-160017924 GATACAGTGGTGAACAAGACAGG + Intronic
1000411978 5:160943107-160943129 AACACTGTGTTGAATAGGAGTGG + Intergenic
1000890462 5:166795668-166795690 AACTCAGTGGTGATTGGGAATGG - Intergenic
1001308889 5:170596504-170596526 GCCACAGTAGGGAAGAGGAATGG + Intronic
1001662397 5:173404828-173404850 AACACTGTGTTGAATAGGAGCGG + Intergenic
1001771005 5:174295717-174295739 GGCACAGTGATGAAGAGGACAGG - Intergenic
1001839334 5:174860979-174861001 GATACTGTGTTGAATAGGAGTGG + Intergenic
1003388154 6:5688229-5688251 AACACTGTGTTGAATAGGAGTGG + Intronic
1003702877 6:8489827-8489849 AACACTGTGTTGAATAGGAGTGG + Intergenic
1004181868 6:13387730-13387752 AACACTGTGTTGAATAGGAGTGG - Intronic
1004407899 6:15351636-15351658 AATCCAGTGGTGAATAGGATTGG - Intronic
1006939949 6:37745078-37745100 GACAAAGTGGGGAGCAGGAAGGG + Intergenic
1007935407 6:45728044-45728066 GGCACAGATGTGAATAGGACAGG + Intergenic
1008083057 6:47214149-47214171 AATACTGTGTTGAATAGGAATGG - Intergenic
1008407245 6:51132400-51132422 AATACTGTGTTGAATAGGAATGG + Intergenic
1008671928 6:53778124-53778146 AACACTGTGTTGAATAGGAGTGG - Intergenic
1008978242 6:57453815-57453837 AACACTGTGTTGAATAGGAGTGG + Intronic
1009188706 6:60603928-60603950 AACACTATGTTGAATAGGAATGG - Intergenic
1009361267 6:62817690-62817712 AACACTATGTTGAATAGGAATGG + Intergenic
1010266893 6:73877827-73877849 GCCACAGGGGTGCAGAGGAATGG - Intergenic
1010292182 6:74150300-74150322 AACACTGTGTTGAATAGGAGTGG + Intergenic
1010307280 6:74339813-74339835 AACACTGTGTTGAATAGGAGTGG + Intergenic
1010312266 6:74401275-74401297 AACACTGTGTTGAATAGGAGTGG - Intergenic
1010351964 6:74885312-74885334 AACACTGTGTTGAATAGGAGTGG + Intergenic
1010446581 6:75955628-75955650 AACACTATGTTGAATAGGAATGG + Intronic
1010491899 6:76486794-76486816 AACACTATGTTGAATAGGAATGG + Intergenic
1010598979 6:77800520-77800542 AACACTGTGTTGAATAGGAGTGG + Intronic
1010604787 6:77874634-77874656 AACACTATGTTGAATAGGAATGG + Intronic
1010844411 6:80687312-80687334 AACACGGTGTTGAATAGGAGTGG - Intergenic
1010944160 6:81955067-81955089 AACACTGTGTTGAATAGGAGTGG + Intergenic
1010957366 6:82105262-82105284 AACACTGTGTTGAATAGGAGTGG - Intergenic
1011345866 6:86369082-86369104 GGCACACTGGTGAAAAGGATGGG - Intergenic
1011950222 6:92955964-92955986 AACACTGTGTTGAATAGGAGTGG - Intergenic
1012094941 6:94946107-94946129 AACACTATGGTGAATAGGAGTGG - Intergenic
1012147829 6:95708607-95708629 AACACTATGGTGAATAGGAGTGG - Intergenic
1012159440 6:95864950-95864972 AACACTATGGTGAATAGGAGTGG - Intergenic
1012204216 6:96440714-96440736 AACACTATGTTGAATAGGAATGG - Intergenic
1012336216 6:98061474-98061496 AACACTGTGTTGAATAGGAGTGG + Intergenic
1012747558 6:103113328-103113350 GACACAGTGCTGAATATTCAAGG - Intergenic
1013433396 6:110076796-110076818 CACACAGTGGTGAAGAGCACAGG + Intergenic
1013436991 6:110120153-110120175 AACACTGTGTTGAATAGGAGTGG - Intronic
1013860518 6:114630030-114630052 AACACTATGTTGAATAGGAATGG + Intergenic
1013926316 6:115477066-115477088 AACACTGTGTTGAATAGGAGTGG + Intergenic
1014277598 6:119404072-119404094 AACACTGTGTTGAATAGGAGTGG - Intergenic
1014337486 6:120155430-120155452 AACACTGTGTTGAATAGGAGTGG + Intergenic
1014345545 6:120265420-120265442 AACACTGTGTTGAATAGGAGTGG + Intergenic
1014677721 6:124388278-124388300 GACATAATAGTGAATAGAAAGGG - Intronic
1014715109 6:124855778-124855800 AACACTGTGTTGAATAGGAGTGG - Intergenic
1014924931 6:127259122-127259144 AACACTGTGTTGAATAGGACTGG - Intergenic
1015368216 6:132421572-132421594 GATACTATGTTGAATAGGAATGG + Intergenic
1015770358 6:136762237-136762259 GACAGAGAGGTAAATGGGAAGGG + Intronic
1016226942 6:141749988-141750010 AACACTATGGTGAATAGGAGTGG - Intergenic
1016245338 6:141973634-141973656 AACACTGTGTTGAATAGGAGTGG - Intergenic
1016265766 6:142231396-142231418 GACACTATGTTGAATAGGAGTGG + Intergenic
1016656271 6:146521815-146521837 AACACTATGTTGAATAGGAATGG + Intergenic
1018607099 6:165609470-165609492 AACACTATGTTGAATAGGAATGG - Intronic
1019106498 6:169671852-169671874 GACACAGTGGTGAATAGGAAGGG - Intronic
1019367085 7:639145-639167 GAGACAGTTTTGAAAAGGAACGG + Intronic
1020527429 7:9280300-9280322 GACTTGGTGATGAATAGGAAAGG + Intergenic
1020640770 7:10751184-10751206 GACACTATGTTGAATAGGAGTGG - Intergenic
1020754388 7:12183340-12183362 AACACTGTGTTGAATAGGAGTGG - Intergenic
1021307534 7:19049856-19049878 AACACTGTGTTGAATAGGAGTGG - Intronic
1021321422 7:19217564-19217586 AACACTGTGGTGAATAGGAGTGG - Intergenic
1021425978 7:20499951-20499973 AACACTATGTTGAATAGGAAAGG - Intergenic
1021747405 7:23756523-23756545 AATACTGTGGTGAATAGGAGTGG + Intronic
1022453950 7:30541582-30541604 AACACTATGTTGAATAGGAATGG - Intronic
1022576584 7:31503229-31503251 AACACTGTGTTGAATAGGAGTGG + Intergenic
1022592577 7:31679828-31679850 GACACAGTGGGGATTAGGCTTGG + Intergenic
1022880324 7:34579887-34579909 GACACTATGTTGAATAGGAGTGG - Intergenic
1023146592 7:37157278-37157300 AACACTATGTTGAATAGGAATGG - Intronic
1023568796 7:41551611-41551633 AACACTGTGTTGAATAGGAGTGG + Intergenic
1023763826 7:43492272-43492294 GACAGAATGTTGAATAGTAAAGG - Intronic
1024351638 7:48371817-48371839 AATACAGTGTTGAATAGGAGTGG + Intronic
1024556229 7:50605398-50605420 GACACTGCGCTGAAAAGGAAAGG + Exonic
1025874367 7:65466520-65466542 AACACTGTGTTGAATAGGAGTGG + Intergenic
1027351051 7:77311764-77311786 GACAAAGAAGTGAATAGGGAAGG + Intronic
1027397112 7:77767696-77767718 GAGACAGAGGTGAAGGGGAAGGG - Intronic
1028055136 7:86231619-86231641 AACACTATGTTGAATAGGAATGG - Intergenic
1028300648 7:89195301-89195323 AACACTATGTTGAATAGGAATGG - Intronic
1028324520 7:89505709-89505731 AACACTGTGTTGAATAGGAGTGG - Intergenic
1028395671 7:90365793-90365815 AACACTGTGTTGAATAGGAGTGG + Intronic
1028508264 7:91593757-91593779 AACACTGTGTTGAATAGGAGTGG - Intergenic
1028524012 7:91763148-91763170 AACACTGTGTTGAATAGGAGTGG - Intronic
1028666150 7:93345940-93345962 AACACTGTGTTGAATAGGATTGG - Intronic
1028751000 7:94382884-94382906 GACACAGTAGTGAATAAGACAGG + Intergenic
1029135899 7:98370954-98370976 GACACACTTGTGAATAGAAAGGG + Intronic
1029322304 7:99774804-99774826 GACACTATGTTGAATAGGAGTGG - Intronic
1030212487 7:107010263-107010285 GAGATAATGGTCAATAGGAATGG - Intergenic
1030817882 7:114059032-114059054 AACACTGTGTTGAATAGGAGTGG - Intronic
1030833174 7:114251819-114251841 AACACTGTGTTGAATAGGAGTGG + Intronic
1030997406 7:116375350-116375372 AACACTATGTTGAATAGGAATGG - Intronic
1031270986 7:119649188-119649210 AACACTGTGTTGAATAGGAGTGG - Intergenic
1031527426 7:122838391-122838413 AACACTATGTTGAATAGGAATGG - Intronic
1032327029 7:130938695-130938717 TACACAGGGCTGAATAGGCAGGG - Intergenic
1033838232 7:145341832-145341854 AACACTGTGTTGAATAGGAGTGG - Intergenic
1033979142 7:147142102-147142124 AACACTGTGTTGAATAGGAGTGG + Intronic
1034932012 7:155169991-155170013 GACGCAGTGGTGAGGAGGACAGG + Intergenic
1035008430 7:155688505-155688527 AACACTGTGTTGAATAGGAGTGG + Intronic
1035228954 7:157450452-157450474 GACACTGTGTTGAGTAGGAGTGG + Intergenic
1035586097 8:775378-775400 AACACTGTGTTGAATAGGAGTGG + Intergenic
1035858779 8:3005884-3005906 GACACTATGTTGAATAGGAGTGG - Intronic
1036579534 8:10061152-10061174 GACACAGTGGAGAAAAAGACTGG - Intronic
1038141504 8:24850193-24850215 GATACAAAGGTCAATAGGAATGG - Intergenic
1038407583 8:27333634-27333656 AAGACAGAGGTGAAGAGGAATGG - Intronic
1038834010 8:31098524-31098546 GACTCAGTGTTGAATAAAAAGGG + Intronic
1039097191 8:33899075-33899097 AACACTGTGTTGAATAGGAGTGG + Intergenic
1039145983 8:34447760-34447782 AACACTGTGTTGAATAGGAATGG + Intergenic
1039718827 8:40140249-40140271 GACACTATGTTGAATAGGAATGG + Intergenic
1040086321 8:43346464-43346486 AACACTGTGTTGAATAGGAGTGG + Intergenic
1040390533 8:46946547-46946569 AACACTGTGTTGAATAGGAGTGG - Intergenic
1040398492 8:47022705-47022727 AACACTGTGTTGAATAGGAGTGG - Intergenic
1040521685 8:48181990-48182012 AACACTGTGTTGAATAGGAGTGG + Intergenic
1040524615 8:48209758-48209780 AACACTGTGTTGAATAGGAGTGG - Intergenic
1040726865 8:50391099-50391121 AACACTGTGTTGAATAGGAGTGG + Intronic
1041021499 8:53643059-53643081 GACTCAGTGGAGAAAAGGAGGGG - Intergenic
1041973197 8:63767079-63767101 AACACTGTGTTGAATAGGAGTGG + Intergenic
1042115831 8:65430450-65430472 CACACTATGTTGAATAGGAATGG - Intergenic
1042116486 8:65437407-65437429 CACACTATGTTGAATAGGAATGG - Intergenic
1042128701 8:65565180-65565202 AACACTATGGTGAATAGGAGTGG + Intergenic
1042362484 8:67898364-67898386 AACACTGTGTTGAATAGGAGTGG - Intergenic
1042541480 8:69911644-69911666 AACACTGTGTTGAATAGGAGTGG - Intergenic
1042609669 8:70584395-70584417 AACACTGTGTTGAATAGGAGTGG - Intronic
1042778317 8:72460661-72460683 AATACACTGGTGAATAGAAATGG + Intergenic
1043244066 8:77975770-77975792 AACACTATGTTGAATAGGAATGG + Intergenic
1043279779 8:78448953-78448975 AACACTGTGTTGAATAGGAATGG - Intergenic
1043303822 8:78769146-78769168 AACACTGTGTTGAATAGGAGTGG - Intronic
1043462480 8:80474350-80474372 AACACAATGTTGAATAGGAGTGG + Intergenic
1043498293 8:80827037-80827059 AACACTGTGTTGAATAGGAGTGG - Intronic
1043535648 8:81201327-81201349 AACACTGTGTTGAATAGGAGTGG + Intergenic
1043725493 8:83605532-83605554 AACACTGTGTTGAATAGGAGTGG - Intergenic
1043911573 8:85870321-85870343 AACACTGTGTTGAATAGGAGTGG + Intergenic
1044037398 8:87323831-87323853 AACACTGTGTTGAATAGGAGTGG + Intronic
1044053576 8:87540273-87540295 AACACTATGTTGAATAGGAATGG + Intronic
1044113665 8:88306890-88306912 AATACTGTGTTGAATAGGAATGG - Intronic
1044410162 8:91873487-91873509 AACACTATGTTGAATAGGAATGG - Intergenic
1044412115 8:91895312-91895334 AACACTATGTTGAATAGGAATGG - Intergenic
1044453554 8:92366219-92366241 AACACTGTGTTGAATAGGAGTGG + Intergenic
1044455020 8:92383451-92383473 GACACTGTGTTGAATAGGAGTGG + Intergenic
1044455825 8:92392128-92392150 AACACTGTGTTGAATAGGAATGG + Intergenic
1044548630 8:93487339-93487361 AACACTGTGTTGAATAGGAGTGG - Intergenic
1044596662 8:93965845-93965867 AACACTATGTTGAATAGGAATGG + Intergenic
1044615267 8:94133686-94133708 AACACTGTGTTGAATAGGAGTGG + Intronic
1045090971 8:98742692-98742714 AACACTGTGTTGAATAGGAGTGG - Intronic
1045103881 8:98871871-98871893 AACACTGTGTTGAATAGGAGTGG + Intronic
1045749613 8:105467537-105467559 GATACAGTGGTCAGTAGGACAGG + Intronic
1045774897 8:105791119-105791141 AACACTGTGTTGAATAGGAGTGG + Intronic
1046329375 8:112695694-112695716 AACACTATGTTGAATAGGAATGG - Intronic
1046810871 8:118531956-118531978 AACACTATGTTGAATAGGAATGG + Intronic
1046828642 8:118719745-118719767 AACACTGTGTTGAATAGGAATGG + Intergenic
1046866935 8:119161425-119161447 AACACTATGTTGAATAGGAATGG + Intergenic
1046874410 8:119237901-119237923 AACACTATGTTGAATAGGAATGG - Intronic
1047831190 8:128632104-128632126 GACACACTGATGAATAACAATGG + Intergenic
1048147475 8:131859686-131859708 AACACAGTGCTGAATAAGAGGGG + Intergenic
1048351219 8:133618283-133618305 GACACAGAGGTGAGCTGGAAAGG - Intergenic
1048450042 8:134525073-134525095 GTCACAGTGGACAATAGCAAAGG - Intronic
1048491279 8:134896097-134896119 GAGACAGTGGCGGATAGGCAGGG - Intergenic
1048755143 8:137730313-137730335 GACACAGTGGTCCTTAGGTATGG + Intergenic
1050387370 9:5105021-5105043 AACACAGTGTTGAATAGGAATGG - Intronic
1050421852 9:5473839-5473861 AACACTGTGTTGAATAGGAGTGG + Intergenic
1050446116 9:5724588-5724610 AACACTGTGTTGAATAGGAGTGG + Intronic
1050624134 9:7485744-7485766 CACCAAGTGGGGAATAGGAAAGG + Intergenic
1050728573 9:8680941-8680963 AACACAATGGAGGATAGGAAAGG + Intronic
1051179325 9:14394121-14394143 GATGCAGGGGTGAATAAGAAAGG + Intronic
1051300784 9:15648360-15648382 AACACTATGTTGAATAGGAATGG - Intronic
1051676636 9:19565075-19565097 AACACTGTGTTGAATAGGAGTGG - Intronic
1051702361 9:19837530-19837552 AACACTGTGTTGAATAGGAGTGG - Intergenic
1051727877 9:20106811-20106833 AACACTGTGTTGAATAGGAGTGG - Intergenic
1051805741 9:20990753-20990775 GATACAGTGGTGATGAGCAAGGG + Intronic
1052114730 9:24636598-24636620 AATACAATGTTGAATAGGAATGG + Intergenic
1052426122 9:28307542-28307564 AACACTGTGTTGAATAGGAGTGG - Intronic
1052623713 9:30946618-30946640 AAGACAGTGATGAATAGTAATGG - Intergenic
1052645263 9:31226536-31226558 AACACTATGTTGAATAGGAATGG + Intergenic
1052705951 9:31993918-31993940 GACACTATGTTGAATAGGATTGG - Intergenic
1052724540 9:32213858-32213880 AACACTGTGTTGAATAGGAGTGG + Intergenic
1053047614 9:34933131-34933153 GAAATAGTGGTGAATATAAAAGG - Intergenic
1053583281 9:39429407-39429429 AACACTATGTTGAATAGGAATGG - Intergenic
1053658908 9:40249819-40249841 GACACAGCTCTGAATAGCAAGGG + Intronic
1053909275 9:42879090-42879112 GACACAGCTCTGAATAGCAAAGG + Intergenic
1054104861 9:60988150-60988172 AACACTATGTTGAATAGGAATGG - Intergenic
1054371028 9:64396109-64396131 GACACAGCTCTGAATAGCAAGGG + Intronic
1054525690 9:66126403-66126425 GACACAGCTCTGAATAGCAAGGG - Intronic
1054678660 9:67885838-67885860 GACACAGCTCTGAATAGCAAGGG + Intronic
1054890349 9:70244408-70244430 AACACTATGTTGAATAGGAATGG - Intergenic
1054997729 9:71411215-71411237 AACACTGTGTTGAATAGGAGTGG - Intronic
1055545884 9:77372597-77372619 GACACTATGTTGAATAGGAGTGG - Intronic
1056008763 9:82302996-82303018 GACATAGCAGTGACTAGGAAAGG + Intergenic
1057768725 9:97947370-97947392 GACACTATGTTGAATAGGAGTGG + Intergenic
1058036165 9:100255442-100255464 AACACTGTGTTGAATAGGAGTGG + Intronic
1058351360 9:104028495-104028517 GACACAGTGGTGGACAGGGTAGG + Intergenic
1058917124 9:109578480-109578502 GACAGAGAGGTCAGTAGGAAGGG + Intergenic
1059126165 9:111687787-111687809 GCCACAGTCAGGAATAGGAAGGG - Intronic
1059524157 9:114974554-114974576 AACACTGTGTTGAATAGGAGTGG + Intergenic
1060335045 9:122713910-122713932 AACACTGTGTTGAATAGGAGTGG - Intergenic
1060616006 9:125014142-125014164 AACACTGTGTTGAATAGGAGTGG - Intronic
1203694681 Un_GL000214v1:86891-86913 GACACAGCTCTGAATAGCAAGGG - Intergenic
1203704868 Un_KI270742v1:30541-30563 GACACAGCTCTGAATAGCAAGGG + Intergenic
1203559135 Un_KI270744v1:35270-35292 GACACAGCTCTGAATAGCAAGGG - Intergenic
1203641592 Un_KI270751v1:17172-17194 GACACAGCTCTGAATAGCAAGGG + Intergenic
1186563922 X:10642129-10642151 AACACTGTGTTGAATAGGAGTGG - Intronic
1187259267 X:17670122-17670144 GACACAATGGTGAAAGGGATGGG + Intronic
1187769631 X:22680924-22680946 AACACTATGTTGAATAGGAATGG - Intergenic
1187844423 X:23522283-23522305 AACACTGTGTTGAATAGGAGTGG - Intergenic
1188669944 X:32869927-32869949 AATACAGTGTTGAATAGGAATGG - Intronic
1189368972 X:40412769-40412791 GAGACAGATGTGAATAGGCATGG - Intergenic
1189603809 X:42654805-42654827 AACACTGTGTTGAATAGGAGTGG - Intergenic
1190601123 X:52093903-52093925 AACACTGTGTTGAATAGGAGTGG - Intergenic
1190606351 X:52147357-52147379 AACACTATGTTGAATAGGAATGG + Intergenic
1190687078 X:52884602-52884624 GACACTATGTTGAATAGGAGTGG + Intergenic
1190698904 X:52971190-52971212 GACACTATGTTGAATAGGAGTGG - Intronic
1190836465 X:54105521-54105543 AACACTATGTTGAATAGGAATGG - Intronic
1190975915 X:55400635-55400657 AACACTGTGTTGAATAGGAGTGG - Intergenic
1191007187 X:55722158-55722180 GACAAAGTAGGGAAAAGGAAAGG - Intronic
1191069975 X:56390510-56390532 AACACTGTGTTGAATAGGAGTGG + Intergenic
1191173211 X:57471208-57471230 AACACTATGTTGAATAGGAATGG - Intronic
1191196336 X:57727506-57727528 AACACTATGTTGAATAGGAATGG + Intergenic
1191203239 X:57807061-57807083 AACACTATGTTGAATAGGAATGG + Intergenic
1191209203 X:57867256-57867278 AACACTATGTTGAATAGGAATGG - Intergenic
1191238640 X:58159753-58159775 AACACTATGTTGAATAGGAATGG - Intergenic
1191604752 X:63049106-63049128 AACACAGTGTTGAATAGGAGTGG - Intergenic
1191614136 X:63150110-63150132 AACACAGTGTTGAATAGGAGTGG - Intergenic
1191622160 X:63228817-63228839 AACACAGTGTTGAATAGGAGTGG + Intergenic
1191660743 X:63647259-63647281 AACACTATGTTGAATAGGAATGG + Intronic
1191707397 X:64108450-64108472 AAAACAATGTTGAATAGGAATGG + Intergenic
1191827907 X:65385673-65385695 AACACTGTGTTGAATAGGAATGG + Intronic
1192008025 X:67238193-67238215 AACACTATGTTGAATAGGAATGG - Intergenic
1192015292 X:67323341-67323363 AACACTGTGTTGAATAGGAGTGG + Intergenic
1192048944 X:67705674-67705696 AACACTATGTTGAATAGGAATGG + Intronic
1192379934 X:70605154-70605176 GAAAGAGTGGTCCATAGGAAGGG + Intronic
1192666726 X:73095961-73095983 AACACTGTGTTGAATAGGATTGG + Intergenic
1192728175 X:73774525-73774547 AACACTGTGTTGAATAGGAGTGG - Intergenic
1192876589 X:75235910-75235932 AACACAATGTTGAATAGGAGTGG - Intergenic
1192900768 X:75493895-75493917 AACACTGTGTTGAATAGGAGTGG - Intronic
1193333192 X:80258362-80258384 GAATCAGTGGTAAATAGGACTGG - Intergenic
1193376769 X:80770714-80770736 AACACTATGGTGAATAGGAGTGG - Intronic
1193547852 X:82851664-82851686 AACACTGTGTTGAATAGGAGTGG + Intergenic
1193566716 X:83085696-83085718 AACACTGTGTTGAATAGGAGTGG + Intergenic
1193634221 X:83928388-83928410 AACACTGTGGTGAATAGGAGTGG + Intergenic
1193686642 X:84584582-84584604 GAAAAAGAGGTGAGTAGGAAGGG + Intergenic
1193695345 X:84701169-84701191 AACACTGTGTTGAATAGGAGTGG - Intergenic
1193735443 X:85150928-85150950 AACACTGTGTTGAATAGGAGCGG - Intergenic
1193766353 X:85533177-85533199 AACACTATGTTGAATAGGAATGG - Intergenic
1193781901 X:85713129-85713151 AACACTGTGTTGAATAGGAGTGG - Intergenic
1193839945 X:86397419-86397441 AACACTATGGTGAATAGGAGTGG + Intronic
1194341402 X:92710741-92710763 GACACAGTGGCAAATAGTTACGG + Intergenic
1194423563 X:93707872-93707894 AACACCGTGGTGAATAAGATAGG + Intronic
1194625154 X:96218633-96218655 GATACTATGTTGAATAGGAATGG - Intergenic
1194927314 X:99841002-99841024 AACACTATGTTGAATAGGAATGG - Intergenic
1195469415 X:105216072-105216094 AACACTGTGTTGAATAGGAGTGG - Intronic
1195531573 X:105963695-105963717 AACACTGTGTTGAATAGGAGTGG - Intergenic
1195606318 X:106809570-106809592 TATACAGTGGTGAATAAGACAGG + Intronic
1195723201 X:107887152-107887174 AACACTGTGTTGAATAGGAGTGG + Intronic
1195957128 X:110343455-110343477 AACACTGTGTTGAATAGGAGTGG - Intronic
1196040582 X:111198667-111198689 GACACATAGATGAATAGGACAGG - Intronic
1196207584 X:112958288-112958310 GACACAGTGGTGTACAAAAATGG + Intergenic
1196511415 X:116516637-116516659 GACACTGTGTTGAATAGGAGTGG + Intergenic
1196831408 X:119778662-119778684 GATGCAGTGGTGAATAGGTTGGG - Intergenic
1197447088 X:126563705-126563727 AACACTATGTTGAATAGGAATGG + Intergenic
1197448337 X:126580200-126580222 AACACTATGTTGAATAGGAATGG + Intergenic
1197573737 X:128181791-128181813 AACACTGTGTTGAATAGGAGTGG - Intergenic
1197736759 X:129855675-129855697 AACACTGTGTTGAATAGGAGTGG + Intergenic
1197764028 X:130047814-130047836 GAGACAATGGTGAACAGGACAGG + Intronic
1197790907 X:130252878-130252900 AATACTGTGTTGAATAGGAACGG - Intronic
1197987880 X:132286501-132286523 AACACTATGTTGAATAGGAAAGG + Intergenic
1198474125 X:136979154-136979176 AACACTATGTTGAATAGGAATGG + Intergenic
1198564354 X:137888708-137888730 GACAAAGAGGTACATAGGAAGGG - Intergenic
1199483875 X:148327532-148327554 GACACCATGTTGAATAGGAGTGG + Intergenic
1199976243 X:152896558-152896580 GACCCAGTGATGAATCAGAAGGG + Intergenic
1200298094 X:154943130-154943152 AACACTATGTTGAATAGGAAAGG - Intronic
1200583407 Y:4977345-4977367 AACACTATGTTGAATAGGAATGG - Intergenic
1200649753 Y:5827453-5827475 GACACAGTGGCAAATAGTTACGG + Intergenic
1200692888 Y:6325708-6325730 AAAACTGTGGTGAATAGGAATGG - Intergenic
1200704750 Y:6432664-6432686 AACACTGTGTTGAATAGGAGTGG + Intergenic
1200712549 Y:6500929-6500951 AAAACTGTGGTGAATAGGAGTGG + Intergenic
1200774304 Y:7156134-7156156 AACACTATGTTGAATAGGAACGG + Intergenic
1200887984 Y:8290742-8290764 GATACTATGTTGAATAGGAATGG + Intergenic
1200899139 Y:8410001-8410023 AACACAATGTTGAATAGGAGTGG + Intergenic
1201021369 Y:9661109-9661131 AAAACTGTGGTGAATAGGAGTGG - Intergenic
1201029361 Y:9732044-9732066 AACACTGTGTTGAATAGGAGTGG - Intergenic
1201042384 Y:9849018-9849040 AAAACTGTGGTGAATAGGAATGG + Intergenic
1201263647 Y:12184940-12184962 AACACTGTGTTGAATAGGAGTGG - Intergenic
1201308611 Y:12573650-12573672 GACACTATGTTGAATAGGAGTGG - Intergenic
1201392794 Y:13516466-13516488 GACACTATGTTGAATAGGAGTGG + Intergenic
1201952652 Y:19582507-19582529 AACACTGTGTTGAATAGGAGTGG + Intergenic
1202034381 Y:20616881-20616903 AACACTGTGTTGAATAGGAGTGG + Intergenic
1202112684 Y:21440198-21440220 AATACTGTGGTGAATAGGAGGGG + Intergenic
1202175012 Y:22090161-22090183 AACACTATGTTGAATAGGAATGG - Intronic
1202216350 Y:22496222-22496244 AACACTATGTTGAATAGGAATGG + Intronic
1202326836 Y:23699842-23699864 AACACTATGTTGAATAGGAATGG - Intergenic
1202357037 Y:24062746-24062768 AACACTATGTTGAATAGGAATGG - Intergenic
1202361155 Y:24111705-24111727 AACACTATGTTGAATAGGAATGG + Intergenic
1202509623 Y:25558413-25558435 AACACTATGTTGAATAGGAATGG - Intergenic
1202513740 Y:25607368-25607390 AACACTATGTTGAATAGGAATGG + Intergenic
1202543933 Y:25970210-25970232 AACACTATGTTGAATAGGAATGG + Intergenic
1202577529 Y:26343640-26343662 AACACTGTGTTGAATAGGAGTGG - Intergenic