ID: 1019107637

View in Genome Browser
Species Human (GRCh38)
Location 6:169681976-169681998
Sequence CCAACTCCTCCTGTTGAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 173}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019107632_1019107637 -10 Left 1019107632 6:169681963-169681985 CCCAGTCCCAGCTCCAACTCCTC 0: 1
1: 1
2: 9
3: 79
4: 652
Right 1019107637 6:169681976-169681998 CCAACTCCTCCTGTTGAAATCGG 0: 1
1: 0
2: 0
3: 9
4: 173
1019107626_1019107637 15 Left 1019107626 6:169681938-169681960 CCACCCACAGCAGATCATAAGGG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1019107637 6:169681976-169681998 CCAACTCCTCCTGTTGAAATCGG 0: 1
1: 0
2: 0
3: 9
4: 173
1019107630_1019107637 12 Left 1019107630 6:169681941-169681963 CCCACAGCAGATCATAAGGGGGC 0: 1
1: 0
2: 6
3: 37
4: 123
Right 1019107637 6:169681976-169681998 CCAACTCCTCCTGTTGAAATCGG 0: 1
1: 0
2: 0
3: 9
4: 173
1019107623_1019107637 28 Left 1019107623 6:169681925-169681947 CCTCTCTAGTCTCCCACCCACAG 0: 1
1: 0
2: 4
3: 33
4: 273
Right 1019107637 6:169681976-169681998 CCAACTCCTCCTGTTGAAATCGG 0: 1
1: 0
2: 0
3: 9
4: 173
1019107631_1019107637 11 Left 1019107631 6:169681942-169681964 CCACAGCAGATCATAAGGGGGCC 0: 1
1: 0
2: 7
3: 37
4: 137
Right 1019107637 6:169681976-169681998 CCAACTCCTCCTGTTGAAATCGG 0: 1
1: 0
2: 0
3: 9
4: 173
1019107624_1019107637 16 Left 1019107624 6:169681937-169681959 CCCACCCACAGCAGATCATAAGG 0: 1
1: 0
2: 2
3: 21
4: 154
Right 1019107637 6:169681976-169681998 CCAACTCCTCCTGTTGAAATCGG 0: 1
1: 0
2: 0
3: 9
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019107637 Original CRISPR CCAACTCCTCCTGTTGAAAT CGG Intronic
900735178 1:4295227-4295249 CCAACTACTCCTGTTTATTTGGG - Intergenic
908061911 1:60359553-60359575 CCAAATCATCCAGTTGAGATGGG + Intergenic
908443510 1:64178712-64178734 CCAAATCATCCTGGTGGAATGGG + Exonic
910792288 1:91063984-91064006 CCTACTCCTCCCCTTGACATTGG + Intergenic
911268395 1:95771621-95771643 CCAAATCTTCCATTTGAAATTGG + Intergenic
911837010 1:102632642-102632664 ATAACTGCTCCAGTTGAAATGGG - Intergenic
917952023 1:180048684-180048706 CCATCTCTTCCTGATGAAAAAGG + Exonic
918081157 1:181208752-181208774 CCAACTTCTCTTGTTGTGATGGG - Intergenic
918239849 1:182611650-182611672 CCTACTCTCCCTGTTGACATGGG - Intergenic
922756750 1:228101203-228101225 CCAACTCCCCCTGCTGTAAGAGG - Exonic
923753442 1:236768638-236768660 CCAACTCTTCCTGATTATATTGG + Intergenic
923983214 1:239350159-239350181 CCAACTATTTCTATTGAAATTGG + Intergenic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1064428769 10:15253829-15253851 CCCACTCCTCCTGGTGGAAGAGG - Intronic
1066136274 10:32449711-32449733 CCAAATTCGCATGTTGAAATTGG + Intronic
1067546151 10:47194022-47194044 CAAATTCCTCATTTTGAAATGGG - Intergenic
1068784254 10:60953119-60953141 ATAACTCCATCTGTTGAAATGGG - Intronic
1069065175 10:63935100-63935122 CCAATTCTTCCTGTTGGAAGAGG + Intergenic
1072752399 10:97991538-97991560 CAAACTCCTCCTGTTATATTAGG + Intronic
1074013118 10:109504617-109504639 CCAACTCCTCATCCTGAAAGAGG + Intergenic
1075951404 10:126480942-126480964 CAAACTCCTCCTGGTGTGATCGG + Intronic
1078738844 11:14047839-14047861 CAATCTCTTCCTGTTGACATTGG - Intronic
1085811043 11:79681331-79681353 TCAACTCTTCCTGATGAATTTGG - Intergenic
1091684060 12:2549195-2549217 CCAAGTCAGCCTGTTGACATGGG + Intronic
1091724455 12:2835767-2835789 CCACTTCCGCCTGCTGAAATTGG + Intronic
1094326156 12:29241751-29241773 CCAAGTCCTGCTGCTGGAATAGG - Intronic
1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG + Intronic
1101173400 12:102123046-102123068 ACAATTCCTCCTGTTGTAATAGG + Intronic
1102494607 12:113310885-113310907 CCAACTCCTAGTGGTGAAAAGGG - Intronic
1102684808 12:114716496-114716518 CCAACACCACCTGGTGAACTTGG - Intergenic
1104239531 12:126974559-126974581 CTAACGCCTCATGCTGAAATAGG + Intergenic
1106892603 13:34262377-34262399 CTAACTCCTCCTGCTGCACTTGG - Intergenic
1107166314 13:37284873-37284895 CAAACTCCTCCTGTCAAAACTGG + Intergenic
1107503891 13:41011422-41011444 CCAATCCCTCTTGCTGAAATAGG + Intronic
1107995983 13:45861490-45861512 TCATCTCTTCCTGTTGAAAGGGG - Intergenic
1109591092 13:64483705-64483727 CCACCTTCTCCTTTTAAAATTGG + Intergenic
1112180252 13:97070941-97070963 CCAGCTGCTCCTGTGGAGATAGG - Intergenic
1112491810 13:99872580-99872602 TAAACACCTCCTGGTGAAATAGG + Intronic
1114181464 14:20371598-20371620 CTAAGTCCTCCTGTAGAATTCGG + Exonic
1114833171 14:26169752-26169774 CCCAAACCTCATGTTGAAATTGG - Intergenic
1118093432 14:62509045-62509067 CCAACTCTTCCTGTTATCATGGG - Intergenic
1118336230 14:64855672-64855694 TCAATTCCTCTTGTTGATATTGG + Intronic
1118456538 14:65949918-65949940 CCATCTCCTCCTGATGAAAAGGG - Intergenic
1119365693 14:74089797-74089819 AAAAGTCCTCATGTTGAAATAGG + Intronic
1121442246 14:93956586-93956608 CCCACTGCTCCTGCTGAGATGGG - Intronic
1121837454 14:97104851-97104873 CCCAGTCCTCCTAGTGAAATGGG - Intergenic
1122339413 14:101018619-101018641 CCATGTCCTCCTGGAGAAATTGG - Intergenic
1202843778 14_GL000009v2_random:148298-148320 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1202913183 14_GL000194v1_random:138538-138560 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1202879473 14_KI270722v1_random:44147-44169 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1125121324 15:36162060-36162082 CCCACCCCTCCTTTTCAAATGGG + Intergenic
1129564785 15:76609934-76609956 CCAATTCTACCTGGTGAAATGGG - Intronic
1129681330 15:77660061-77660083 CCAACTCCTCCTCTTCAGAATGG - Intronic
1130056252 15:80528524-80528546 CCACAACCTCATGTTGAAATTGG + Intronic
1131843272 15:96461244-96461266 GCAAGTCCTGCTGGTGAAATTGG - Intergenic
1133687867 16:8183486-8183508 CCAGCTCCTCCTCTTGCAGTTGG + Intergenic
1134032933 16:11007117-11007139 CAAACTCCTCATGTAAAAATAGG + Intronic
1135953710 16:26938435-26938457 CCAACTCCTCCAACTTAAATGGG + Intergenic
1139204335 16:65012353-65012375 CCACCTCCTCGTTTTGAACTAGG - Intronic
1140962213 16:79927077-79927099 GTAAATCCTCCTGTTGGAATTGG + Intergenic
1141663372 16:85453497-85453519 CGACCTCCTCCTGATGAAAGAGG - Intergenic
1145378595 17:22374813-22374835 CCACCTCCACCTGTAGAAATCGG + Intergenic
1148516356 17:48221920-48221942 CCCACTCCTCCTGATGATAAAGG + Intronic
1148651785 17:49255300-49255322 AGAACTCCTCGTGTTGAAGTGGG - Intergenic
1151043505 17:70892940-70892962 CCAACTCCCCCTGATAAAAAGGG + Intergenic
1153471469 18:5451211-5451233 CCAACTCATCATCTTGAAAATGG - Intronic
1157159316 18:45298789-45298811 CCCACTCCTCCCATTGAATTAGG - Intronic
1160896763 19:1406683-1406705 CCACCTCCTTCTGCTGACATTGG + Intergenic
1163385146 19:16995345-16995367 CCCACTCCTGCTGCTGCAATTGG + Intronic
1164060837 19:21672264-21672286 CCAAGTTCTCCTTTTGTAATGGG - Intergenic
1164697562 19:30257795-30257817 GCAGCTCCTCCAGTTGCAATGGG - Intronic
1202655091 1_KI270708v1_random:13156-13178 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
931009465 2:57891964-57891986 CCAACTTGAACTGTTGAAATGGG - Intergenic
931328450 2:61253523-61253545 CCAACTACCCTTCTTGAAATTGG + Intronic
931542857 2:63349027-63349049 CCGAGTTCTCCTGTTGAAGTAGG + Intronic
935025978 2:99277455-99277477 CCAAGTTCTCCTTTTGTAATGGG - Intronic
938722431 2:134078457-134078479 CCAACTAATACTGTTCAAATTGG + Intergenic
942759590 2:179382853-179382875 CCAGCCCCTCCTGCTAAAATTGG + Intergenic
944170640 2:196773043-196773065 GCAACTCAGCCTCTTGAAATCGG + Exonic
1169004906 20:2198631-2198653 CCATCTCCTCATCCTGAAATAGG + Intergenic
1169135615 20:3195344-3195366 CCTCCTCCTCCTGTGGACATAGG + Exonic
1169257473 20:4110190-4110212 CCATTTCCTCGTATTGAAATAGG + Intergenic
1169539561 20:6584135-6584157 CAAACTGCTCCGGTTGAAAGGGG + Intergenic
1170510616 20:17072696-17072718 CCAACACATCCTGTGGAAAATGG - Intergenic
1172781696 20:37440275-37440297 CCAACTCTTCCTGCTGAGCTGGG + Intergenic
1174866478 20:54141399-54141421 CAAACTCCACTTATTGAAATGGG - Intergenic
1175449464 20:59050708-59050730 CCATCTCCTGATGTTGTAATAGG - Intergenic
1175564203 20:59959817-59959839 CCAACTGCCACTGTTTAAATGGG + Intronic
1176632532 21:9153208-9153230 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1176640778 21:9301609-9301631 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1176711563 21:10154752-10154774 CCAATTTCTCCTTTTGTAATGGG - Intergenic
1179066614 21:38030415-38030437 CAAACTCTTCCTGGTGAGATAGG - Intronic
1180349803 22:11790992-11791014 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1180374082 22:12074444-12074466 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1180388405 22:12201260-12201282 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1181596590 22:23919013-23919035 CCAATACCTCCTGTTGCACTTGG + Intergenic
1181997779 22:26896434-26896456 CCAACTCTTGCTGCAGAAATGGG - Intergenic
1182021155 22:27082676-27082698 CCATTTCCTCCTAGTGAAATTGG + Intergenic
951054301 3:18129356-18129378 CCAGCTACTCCTGTTGAACATGG + Intronic
956845171 3:73175875-73175897 ACAATTCATCCTGATGAAATAGG + Intergenic
957784428 3:84863570-84863592 CTAATTCTTCCTGTTGAAAATGG - Intergenic
961769101 3:129235529-129235551 TCAACTCCTCCCTTTGAAAGTGG + Intergenic
962017090 3:131452967-131452989 CCAACTCCTTCTGGATAAATGGG + Intergenic
963880565 3:150523853-150523875 CCCAGTCCTCTTATTGAAATTGG - Intergenic
1202746115 3_GL000221v1_random:103415-103437 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
970230390 4:13904122-13904144 CCAAATCCTCCTTTTGAGAGAGG + Intergenic
974192200 4:58520037-58520059 CCAACTTCTCCACTTGTAATAGG - Intergenic
976512816 4:85930590-85930612 CCAATTCCTGCTGTTTGAATGGG + Intronic
978786812 4:112619135-112619157 CACACTCTTCCTGTTGAATTAGG + Exonic
979731809 4:124032271-124032293 CCAAATTCTCCTGTTGAACTGGG + Intergenic
979936004 4:126697010-126697032 CCAAAGACTCATGTTGAAATTGG + Intergenic
980663705 4:135900231-135900253 TCAAATCCTCATGTAGAAATTGG + Intergenic
980812848 4:137905102-137905124 CCACCTCCTCTTCTTGACATAGG + Intergenic
983368949 4:166834249-166834271 CCAACTCATCTTGCTGTAATTGG + Intronic
1202755665 4_GL000008v2_random:59883-59905 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
987840669 5:23219131-23219153 CAAACTCCATCTGTTGAATTTGG - Intergenic
989654810 5:43734866-43734888 CCAACTCCTCCACTTGTAAATGG - Intergenic
990041575 5:51383480-51383502 CCAACTCCGCCGGCTTAAATTGG + Exonic
995263502 5:110133003-110133025 CCAACTCCTCTGGTAGAATTTGG + Intergenic
996041500 5:118818319-118818341 CAAAGTCTTGCTGTTGAAATAGG - Intergenic
996493753 5:124129566-124129588 CCTACTCCTGCTGTTCAAATAGG - Intergenic
997619464 5:135276172-135276194 TCAAGTCCCCCTGTTGAATTAGG + Intronic
999369567 5:151045744-151045766 CCAACTCCTCATGGTGACCTGGG + Intronic
1000602694 5:163294086-163294108 GAAACTCATCCTGTTGAATTTGG + Intergenic
1000640655 5:163698148-163698170 CCAACTTCTCCTGTCTAGATGGG - Intergenic
1001173221 5:169441428-169441450 CGAGCTCCTCTGGTTGAAATGGG + Intergenic
1002842402 6:917613-917635 CCATCTCCTCCTCTTGACAGGGG - Intergenic
1002872051 6:1176084-1176106 CAAAGGCCTCCTGTTGATATAGG - Intergenic
1003699568 6:8446866-8446888 CCACCTCCTCCCGTTGAATGAGG + Intergenic
1007252056 6:40502451-40502473 CGCACTCCTCCTGTAGACATAGG - Intronic
1011339026 6:86292088-86292110 CCAAGGGCTCATGTTGAAATAGG - Intergenic
1012286115 6:97390559-97390581 CAACCTTCTCCTGTAGAAATAGG - Intergenic
1013718632 6:112995031-112995053 CCTACTCCTCCCCTGGAAATTGG + Intergenic
1014838066 6:126182945-126182967 CCAACAGCCCCAGTTGAAATGGG - Intergenic
1015994673 6:138986227-138986249 CAAATTCATCCTGTTGAAAAGGG - Intronic
1018931208 6:168241605-168241627 CCCTTTCCTCCTGTAGAAATGGG + Intergenic
1019107637 6:169681976-169681998 CCAACTCCTCCTGTTGAAATCGG + Intronic
1021976054 7:26012184-26012206 CAAACTCCACCTCTGGAAATAGG - Intergenic
1022514270 7:30965462-30965484 CCAAATGCTCCTGCTGAATTAGG - Intronic
1024634175 7:51273931-51273953 CCAACTCCCCCTGTAGCAGTTGG + Intronic
1026396326 7:69958131-69958153 CCAACTCCTGCTGTTGAAGATGG - Intronic
1028405363 7:90468145-90468167 CCAACTCCTACTTTGGAAGTAGG - Intronic
1028505879 7:91569539-91569561 CCAATTCATCCTGTTCAGATGGG + Intergenic
1029228552 7:99047177-99047199 CCTGCTTCTCCTGTGGAAATTGG - Intronic
1035530651 8:348243-348265 TCAATTCCTCCTGATGAGATTGG - Intergenic
1035833346 8:2722519-2722541 CTAACTCCTCCTGATGATTTGGG - Intergenic
1039349605 8:36747895-36747917 CCAAGTCCTTCTGTGGAAATTGG + Intergenic
1040438126 8:47413248-47413270 CCATCTCCTCATGTGGAAAAAGG - Intronic
1043302375 8:78749920-78749942 CCAGCTACTCAGGTTGAAATAGG + Intronic
1046260946 8:111766419-111766441 CCAGTTCCTCCTATTGAAATGGG - Intergenic
1047673595 8:127174972-127174994 CCTAAACCTCATGTTGAAATTGG - Intergenic
1047993810 8:130314494-130314516 TCAACTCCTCATTGTGAAATTGG - Intronic
1049490164 8:142894102-142894124 GCAACTCCTGCTGCTGAACTGGG - Intronic
1049932812 9:472517-472539 CCCACTCCTCCTCTTGAATCAGG + Intronic
1050055569 9:1650003-1650025 CAAAATCCTACTGTTGAGATAGG + Intergenic
1050227243 9:3473867-3473889 CAAAATACTGCTGTTGAAATAGG + Intronic
1052301947 9:26962001-26962023 CCAACTCCACCTCTTGAAACAGG - Exonic
1053447434 9:38163847-38163869 CCATGGCCTCCTGTTGAATTGGG + Intergenic
1059698975 9:116757016-116757038 CCTACAGCTCCTGCTGAAATGGG + Intronic
1061253704 9:129441247-129441269 CCAACTCCTCCTGGAGGAAAGGG - Intergenic
1202796318 9_KI270719v1_random:123741-123763 CCAATTTCTCCTTTTGTAATGGG - Intergenic
1203687270 Un_GL000214v1:6926-6948 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1203755364 Un_GL000218v1:120832-120854 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1203714735 Un_KI270742v1:133372-133394 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1203536468 Un_KI270743v1:44719-44741 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1203649005 Un_KI270751v1:97127-97149 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1185511064 X:665602-665624 CCCATTCCTCCTGTGGAATTTGG - Intergenic
1185912652 X:3999608-3999630 CCAGCTCTTACTGGTGAAATTGG - Intergenic
1186479692 X:9886995-9887017 CAAAATCATTCTGTTGAAATCGG - Intronic
1188595158 X:31891426-31891448 CCCAAGTCTCCTGTTGAAATGGG - Intronic
1190042928 X:47086153-47086175 CCAACTCCCCCTTTTTTAATAGG + Intronic
1190131750 X:47754328-47754350 CCCACTCATCTTGCTGAAATGGG + Intergenic
1191083312 X:56537479-56537501 GCAAGTCCTACTGTTGAACTAGG + Intergenic
1197487814 X:127075208-127075230 GCAACTCCTCCTGCTGTACTGGG - Intergenic
1198830342 X:140743817-140743839 CCACCTCCTCCTCTTGACCTTGG + Intergenic
1201745725 Y:17371077-17371099 CCCAAACCTCATGTTGAAATTGG - Intergenic
1202255045 Y:22912314-22912336 ACAATGCCTCCTGTTGAAAAGGG - Intergenic
1202270721 Y:23071567-23071589 ACAATGCCTCCTGTTGAAAGTGG - Intergenic
1202295305 Y:23349115-23349137 ACAATGCCTCCTGTTGAAAGTGG + Intergenic
1202408036 Y:24546063-24546085 ACAATGCCTCCTGTTGAAAAGGG - Intergenic
1202423716 Y:24705311-24705333 ACAATGCCTCCTGTTGAAAGTGG - Intergenic
1202447073 Y:24964774-24964796 ACAATGCCTCCTGTTGAAAGTGG + Intergenic
1202462746 Y:25124018-25124040 ACAATGCCTCCTGTTGAAAAGGG + Intergenic