ID: 1019111980

View in Genome Browser
Species Human (GRCh38)
Location 6:169724132-169724154
Sequence CGCGGGCGGCGCGCTGGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 170}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019111980_1019111998 16 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019111998 6:169724171-169724193 GCTGGGAGGGCGCGGGGCTGCGG 0: 1
1: 1
2: 10
3: 188
4: 1228
1019111980_1019111990 -2 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019111990 6:169724153-169724175 CGCGGGAGGGCGCCAAAGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 114
1019111980_1019112001 26 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019112001 6:169724181-169724203 CGCGGGGCTGCGGGCCGGAATGG 0: 1
1: 1
2: 2
3: 15
4: 254
1019111980_1019111997 10 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019111997 6:169724165-169724187 CCAAAGGCTGGGAGGGCGCGGGG 0: 1
1: 0
2: 1
3: 26
4: 377
1019111980_1019111999 17 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019111999 6:169724172-169724194 CTGGGAGGGCGCGGGGCTGCGGG 0: 1
1: 1
2: 3
3: 103
4: 783
1019111980_1019111995 9 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019111995 6:169724164-169724186 GCCAAAGGCTGGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 359
1019111980_1019111993 3 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019111993 6:169724158-169724180 GAGGGCGCCAAAGGCTGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 364
1019111980_1019112000 21 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019112000 6:169724176-169724198 GAGGGCGCGGGGCTGCGGGCCGG 0: 1
1: 0
2: 12
3: 150
4: 1134
1019111980_1019112002 29 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019112002 6:169724184-169724206 GGGGCTGCGGGCCGGAATGGAGG 0: 1
1: 0
2: 4
3: 48
4: 525
1019111980_1019111992 2 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019111992 6:169724157-169724179 GGAGGGCGCCAAAGGCTGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 309
1019111980_1019111991 -1 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019111991 6:169724154-169724176 GCGGGAGGGCGCCAAAGGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 181
1019111980_1019111994 8 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019111994 6:169724163-169724185 CGCCAAAGGCTGGGAGGGCGCGG 0: 1
1: 0
2: 0
3: 28
4: 301
1019111980_1019111988 -6 Left 1019111980 6:169724132-169724154 CCGTCGCCAGCGCGCCGCCCGCG 0: 1
1: 0
2: 2
3: 23
4: 170
Right 1019111988 6:169724149-169724171 CCCGCGCGGGAGGGCGCCAAAGG 0: 1
1: 0
2: 1
3: 10
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019111980 Original CRISPR CGCGGGCGGCGCGCTGGCGA CGG (reversed) Intronic
900091884 1:924268-924290 GGCGGGCGGCGCGTAGGCGGCGG + Intergenic
900118779 1:1039892-1039914 CGCGGGTGGGGGGCTGGCCAGGG + Intronic
900413908 1:2526405-2526427 GGCGGGCGGGGCGCCGGCGGTGG - Intronic
900633808 1:3652206-3652228 CGCGGGAGGGGCCCTGGCGCCGG + Intronic
906720011 1:47997461-47997483 CGCGGGGGGCGGGGGGGCGAGGG + Intergenic
912174712 1:107141326-107141348 CGCGGGCGGCGTACGGGCGGAGG - Intronic
912246386 1:107965277-107965299 CGAGGGCGGGGCGCGGGGGAGGG + Intergenic
913527965 1:119712224-119712246 CGAGGGGGGCGCGCTGGCCTGGG - Intronic
918332125 1:183471456-183471478 GGCGGGCGGCGGGCTGGAGTCGG - Intergenic
919920854 1:202165729-202165751 CGGGGGCGGCGGGCGGGGGAAGG - Intergenic
922496607 1:226062528-226062550 AGCGGGCGGCGCGCGGGGGAGGG + Intronic
922851165 1:228735335-228735357 GGCGCGCGGCGCGCAGGCGGGGG + Exonic
1063443033 10:6088997-6089019 CGCAGGCGGGGCGCAGGCGCGGG + Intronic
1064086428 10:12349396-12349418 CGAAGGCGGCGCGCTGGAGGCGG + Intergenic
1064086534 10:12349770-12349792 GGCCGGGGGCGCGCTGGGGAGGG - Exonic
1064274233 10:13891876-13891898 GGCGGGCCGGGCGCGGGCGAGGG - Intronic
1065099511 10:22320588-22320610 GGCGGGGCGCGCGCGGGCGACGG - Intronic
1068955280 10:62815332-62815354 CGCGGGCGGCGGGCAGGTGGGGG + Intronic
1071086832 10:81875260-81875282 CGCGGGCCGGGCGCGGGCGCGGG - Intergenic
1072139197 10:92574495-92574517 CGCGGGCCGCGCGCCGGCCGCGG - Intergenic
1073403440 10:103277077-103277099 CTGGGGCGGCGCGCTGGGGGCGG - Intergenic
1076999526 11:315740-315762 CGAGGGTGGGGCGCTCGCGAGGG + Intergenic
1083648460 11:64186419-64186441 CGCGGGCGGCGGGCGGGAGCGGG + Intronic
1084295912 11:68213390-68213412 CGCGGGGGGCGCGACGGCGGCGG - Exonic
1086362072 11:86069397-86069419 CGAGGGCGGTGTGCTGGCGGGGG + Intronic
1090473978 11:127003539-127003561 CGGGGGCGGCGCGCGGGGGAAGG + Intergenic
1091114992 11:133004643-133004665 CTCGGGAGGCCAGCTGGCGAGGG + Intronic
1094565046 12:31591225-31591247 GGTGGGGGGCGCGCTCGCGAGGG + Intergenic
1096784409 12:54009039-54009061 GGCGGGCGGCGAGCGGGCGGCGG - Intronic
1100641886 12:96489932-96489954 CGCTGGCGGGGCACTGGGGAGGG + Intronic
1108407954 13:50124140-50124162 CGCGGACGGCGCTCTGGGGAAGG + Intronic
1110705975 13:78602263-78602285 CGCGGGCGGCGCGGGCGCGGCGG - Exonic
1110775663 13:79405851-79405873 CGCGGGCGGCGCGCGGAGGAGGG - Exonic
1112508145 13:99987818-99987840 CGCGGGTGGCGCGATGGCTGCGG + Intergenic
1113378866 13:109785870-109785892 CGCGGGCGGCGACGAGGCGACGG - Exonic
1113513722 13:110874804-110874826 CGGGGGCGGGGCGCCGGCGCGGG - Intergenic
1113861528 13:113490581-113490603 CGCAGGCGGCGCGCTGGATGTGG - Intronic
1113861556 13:113490666-113490688 AGCGGGCGGCGCGGGGGAGATGG - Exonic
1116018247 14:39432076-39432098 CCCGGGTGGCGCGGTGGCGGCGG - Exonic
1121313679 14:92948783-92948805 CGTGGGCGGCGCCCGGGCGTGGG - Intronic
1121616985 14:95319915-95319937 CGCGGGCGGGGCGCGGGCGCGGG + Intergenic
1122543302 14:102509498-102509520 CGCGGGCGCGGCGCGGGGGACGG + Intronic
1122666753 14:103334934-103334956 CTCGGGGGACGCGCTGGGGATGG + Intronic
1122960896 14:105093299-105093321 TCCGGGCGGCGCGCAGGCGCGGG - Intergenic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124652368 15:31483459-31483481 CGCGGTCGGCGCGTCGGCGTCGG + Exonic
1128370062 15:67033879-67033901 GGCGGGCGGCGCGCGTGCAAGGG - Intergenic
1129189225 15:73927718-73927740 CTCGGGCGGCGGGTTGGCGTAGG - Exonic
1129710747 15:77819270-77819292 CGCGGACGGCGCGCCCGGGACGG - Intronic
1129894071 15:79090781-79090803 GGCGATCTGCGCGCTGGCGAGGG + Intergenic
1132365258 15:101252094-101252116 CGCGGGCGGGGCGCCCGAGAGGG - Intergenic
1132552779 16:560256-560278 GGCGGGGGGCGCGCGGGCGGCGG + Intergenic
1132758142 16:1495922-1495944 CGCTGGCGGTGCCCTGGAGAGGG + Intronic
1133292829 16:4734232-4734254 CGGGGGCGGTGCCCCGGCGAGGG - Intronic
1137655234 16:50153456-50153478 CGCGGGCGGCGCGGTCGCGCAGG - Intronic
1138591233 16:58000678-58000700 GGCGGGCGGCGCGGGGGCCAGGG + Intronic
1141694928 16:85614622-85614644 CGAGGGCAGCGTGCTGGCGGTGG + Intronic
1141840026 16:86568246-86568268 GGCGGGCGGCGCGGCGGCGTAGG - Exonic
1142005980 16:87689811-87689833 CGCGGGCGGCGGGGTGGCCGCGG - Exonic
1142062221 16:88038037-88038059 TGCGGGCGTTGCGCTGCCGAGGG + Intronic
1142474687 17:181728-181750 CGCGGGCGGCGCGGAGCGGAGGG + Intergenic
1145884426 17:28372275-28372297 GGCGGGCGGCGCGCGGGCCGTGG + Exonic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1146062266 17:29613598-29613620 GGCGCGCGTGGCGCTGGCGAGGG - Exonic
1146371005 17:32265779-32265801 CGGGGGCGGCGCGCGGGCGGGGG - Intergenic
1148146899 17:45371775-45371797 GGTGGGCGGCGGGCAGGCGAGGG - Intergenic
1150373518 17:64661908-64661930 GGCGGGCGGCACGGGGGCGACGG + Exonic
1151828719 17:76537636-76537658 CGTGCGCGGCGGGCGGGCGAGGG + Exonic
1152111036 17:78357937-78357959 CCAGGGCTGCGGGCTGGCGAAGG - Exonic
1152617711 17:81345640-81345662 CGCGGGCCCTCCGCTGGCGAAGG + Intergenic
1152628603 17:81399646-81399668 CGCGGGCGGCGCAGAGGCGGCGG - Exonic
1152655851 17:81518976-81518998 CCCCCGCGGCGCGCTGGGGAAGG - Intronic
1157353989 18:46917117-46917139 CGCGGGCGGCGCGGGGGCGGCGG - Intronic
1160745429 19:709077-709099 CGCGGGTGGCGCGCGGGGGAGGG - Intronic
1160861187 19:1237778-1237800 CATGGGCGGCGGGCTGGCGGCGG + Exonic
1161073058 19:2271919-2271941 CCCGGGCGGCGCGCTGCCCGAGG + Exonic
1161216197 19:3096021-3096043 CGGGGGCGGGGCGGTGGGGAAGG + Intronic
1162291693 19:9785594-9785616 CGCGGGCGGCGACTCGGCGAGGG - Intronic
1162470951 19:10871735-10871757 CGCGGGCGGCGCGGGGTCGGCGG + Exonic
1163012228 19:14433397-14433419 AGCGGGCCGCGCGCCGGGGAGGG + Intronic
1163490827 19:17616375-17616397 CGCGGGCGGCGGGCGGGAGGCGG + Intronic
1163681167 19:18683525-18683547 GGCGCGCGGCGCGGGGGCGAAGG - Intergenic
1163720441 19:18895973-18895995 CTGGGGCAGCGCGCTGGCGGCGG - Exonic
1164594976 19:29526557-29526579 CGCGGGGGGCGCGGTGGCGGCGG - Exonic
1165157145 19:33795802-33795824 CGCGCGCGGCGCGATGGAGACGG - Intergenic
1165428339 19:35757595-35757617 CGGGGGCCGCGCGCTGGGGCTGG + Intronic
1165443511 19:35844231-35844253 CGGGGGCCGCCCGCTGGGGAAGG + Exonic
1165854226 19:38870243-38870265 CGCAGGCCCCGCGCTGGAGACGG - Exonic
1166984112 19:46649466-46649488 CGCGGGTCGCGCGCTGCCGGGGG + Exonic
1167080590 19:47274329-47274351 CGCGGGTGGGGCTCTGGCCATGG + Intergenic
1167258152 19:48443151-48443173 CGCGGGCGGCGCGGGGGGCACGG + Exonic
1168728656 19:58606927-58606949 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
1168728664 19:58606957-58606979 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
1168728687 19:58607047-58607069 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
925155918 2:1648909-1648931 CGTGGGCGGCCCGGTGGCGAAGG + Exonic
932757908 2:74421674-74421696 CGCGGGCGGCGCGGTTGCCGGGG - Intronic
932776380 2:74530407-74530429 AGCGGGCGGCGGGCTAGGGACGG - Exonic
933772678 2:85754165-85754187 CGCGGGCGGCGCGCGAGGCAGGG - Exonic
934708747 2:96502175-96502197 CACGGGCGGGGCGCAGGCGAGGG - Intronic
937042637 2:118834071-118834093 CCCGGGCGGCGCCCTGGCAGCGG - Intergenic
941021057 2:160408010-160408032 CGCGGGGGCCGGGCGGGCGATGG - Intronic
941385069 2:164841892-164841914 CGCGGGCGGGGTGCGGGCGCTGG + Intronic
942184983 2:173416330-173416352 CACGGCCGGCGCACTGGCGCTGG - Intergenic
943624221 2:190180789-190180811 CGCGGCGGGCGCGGCGGCGACGG + Intronic
947800829 2:232927851-232927873 CGGGGGCGGCGCGCCGGGGCCGG + Intronic
948492169 2:238320632-238320654 CGCGGGCGGCCAGCGGGCGGCGG + Exonic
1168795887 20:610053-610075 GGCGGGCGGCGGGCGGGCGGCGG - Exonic
1172474524 20:35226876-35226898 CCCGGGCGCCGCGCGGGCGGCGG + Exonic
1173548129 20:43914739-43914761 CGCGGGCGGGGCGGGGGCGGGGG + Intergenic
1173821158 20:46021646-46021668 CGCGGGGGGCGGGCGGGCGGAGG + Intergenic
1174607005 20:51768387-51768409 CGCGGGGGGCGCGGCGGCCAAGG - Exonic
1175260671 20:57672368-57672390 GGCGGGCGGCGCCCAGGGGAGGG + Intronic
1175340931 20:58228587-58228609 GGCGGGCGGAGCGCGGGCGGCGG - Exonic
1175428787 20:58888956-58888978 CGCGGGGGCCGCGATGGCGGGGG - Intronic
1176952654 21:15064903-15064925 CGCGGGTGGCGGGCGGGCGTGGG + Exonic
1178104153 21:29299314-29299336 CCCGGGCGGGCCGCGGGCGAGGG - Intronic
1178513838 21:33229910-33229932 CGCGGGCGCCGCGCCGCCGCCGG - Intronic
1179375458 21:40846762-40846784 GGCGGGCGGCGGGCGGGCGGCGG - Exonic
1180187241 21:46145832-46145854 CGGGGGCGGCTCGGTGGCGGCGG - Exonic
1180891418 22:19291702-19291724 CGCGGGCTGACCGGTGGCGACGG + Exonic
1182236825 22:28883209-28883231 CGGGGGCGGAGCGCGGACGAAGG + Intergenic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
1184086924 22:42270747-42270769 CGGGGGCGGGGCGCTGGGGGCGG + Intronic
1184225796 22:43128262-43128284 GGCGGGCGGCTGGCTGGCGGAGG + Intronic
1184439219 22:44498304-44498326 CGGGGCCGGCGCGGTGGCGGTGG + Intergenic
1184661401 22:45967189-45967211 TGCGGGCCGCCCGCTGGCCAAGG - Intronic
1184680914 22:46071712-46071734 CGCGGCCGGCGCGCTCGGGCGGG + Intronic
1185374242 22:50474826-50474848 CGCGAGCCGCGCCATGGCGAGGG + Exonic
952241144 3:31532609-31532631 GGCGGGCGGCGGGCTAGAGAGGG + Intergenic
952316703 3:32238495-32238517 GGCGGGCGGCGCGGAGGAGAGGG - Intergenic
953908958 3:46882381-46882403 CGCGGACGGGGCGCTGGCTTGGG + Intronic
954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG + Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
954717473 3:52533770-52533792 GGCGGGCGGCGGGCTGGCCGAGG - Exonic
957865015 3:86012435-86012457 CAGGGCCGGCGCGCGGGCGAGGG - Intronic
959591928 3:108091073-108091095 CGCGGGCGGGGAGCAGGCGGGGG - Intergenic
961846515 3:129769149-129769171 CACGTGCGGCCCGCTGGCAATGG - Intronic
963827298 3:149970229-149970251 CGCGGGAGGCGCGCTGTCCGCGG + Intronic
965166262 3:165196735-165196757 CGCTGGCGGAGCTCCGGCGATGG - Intronic
967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG + Intronic
967694522 3:192515245-192515267 CGCGGGCTGCGCGCGGCCAAGGG + Intronic
971358258 4:25914017-25914039 TGCGGGCCGGGCGCTGGCGTTGG - Intronic
975870650 4:78775985-78776007 CGCGGGCAGCGCGCCTGCGCGGG + Intergenic
976184168 4:82429198-82429220 CGCGTGCGGCGCGCTGGGGGAGG + Intronic
978361075 4:107931686-107931708 CGCAGGAGGCGCGCGGGCCAGGG - Exonic
983576968 4:169270828-169270850 CGCGGCCGGCGCGGGGTCGACGG - Intronic
989102769 5:37836966-37836988 CGCTGGCGGCGCTCGGCCGAGGG - Intronic
995224986 5:109690881-109690903 CGCGGGCCCCGGGCTGGCGGGGG - Intronic
1001395899 5:171419593-171419615 CGCGGGCGGCGAGGGGGCGGGGG - Intergenic
1002621975 5:180494470-180494492 CGACGGCGGCGCGGAGGCGAAGG + Exonic
1002691464 5:181053324-181053346 CGCGGGCGGCGGGGCGGGGAGGG + Intronic
1004216756 6:13711194-13711216 AGCGGGCGGCCCGCTGGCGGGGG + Exonic
1005327883 6:24720256-24720278 TGCGGGCGGAGCGGTGGCGGCGG + Exonic
1006477155 6:34263688-34263710 AGCGGGCGGCGCGGCGGCGTCGG - Intergenic
1007451307 6:41941765-41941787 CGCGGGCGGCGGGCGGGCTGGGG - Exonic
1014098245 6:117482799-117482821 CGGCGGCGGCGCACTGGCGCGGG + Exonic
1016400858 6:143678244-143678266 CGCGGGCGCAGGGCTGGCGGCGG + Intronic
1018046317 6:159969283-159969305 TGCGGGCGGCGGGCGGGCGCGGG - Exonic
1018686209 6:166307040-166307062 CCCGGGCTGCCGGCTGGCGAGGG + Exonic
1019111980 6:169724132-169724154 CGCGGGCGGCGCGCTGGCGACGG - Intronic
1019381615 7:727102-727124 GGCGGGCGGCGCGCGGGCACGGG - Exonic
1020796804 7:12686836-12686858 CCCGGGCGGCGCGCGGGCAGGGG + Intronic
1022096271 7:27143362-27143384 GGCGGGCGCCGCGCTGGCGCTGG + Exonic
1022102981 7:27180186-27180208 GGCGGGCGGCGGGCGGGCGCGGG - Intronic
1023221252 7:37921399-37921421 CGAGGGCGGCCTGCTGGCGGGGG + Intronic
1023835514 7:44065155-44065177 CGGGGGCGGCGGGATGTCGAAGG + Exonic
1024499836 7:50093205-50093227 CGCGGACGGTGGGCAGGCGACGG - Exonic
1029735707 7:102464827-102464849 CGCGGACGGCGCGATGGCGGCGG - Exonic
1031899302 7:127392325-127392347 GGCGGGAGGCGCGCGGGCGGAGG + Exonic
1032174560 7:129612307-129612329 GGCGGGCGGCGCGGTGGGGCCGG + Intronic
1034412215 7:150947579-150947601 CCCGGGCGACGGGCGGGCGAGGG - Intronic
1035167541 7:157000461-157000483 CGCGTGGGGCGCGGCGGCGAAGG - Intronic
1035751846 8:2002050-2002072 CGCGGCCGGCGCGCAGGCGGCGG - Exonic
1037902168 8:22694675-22694697 CGCAGCCGGCCCGCGGGCGAGGG + Intergenic
1039476608 8:37842181-37842203 GGGCGGCGGCGCGCTGGAGAAGG + Exonic
1042040045 8:64580765-64580787 CCCGGGCTGCGCGCCGGCGCGGG + Exonic
1043388185 8:79768092-79768114 CGCGGGCGGCGGGGAGGCGCGGG + Intergenic
1045231408 8:100310169-100310191 CGCGGGCGGCGCGCTGGGGCGGG - Intronic
1046871237 8:119208160-119208182 CGCCCGCGGAGCGCTGGCGCTGG + Intronic
1047024504 8:120811588-120811610 CGCGGGCGGCGCGCAGCCCCCGG - Exonic
1049616472 8:143577780-143577802 AGCGGGCGGCGCGGCGGCCACGG - Intronic
1052982274 9:34458174-34458196 GGCGGGCGGCGGGCAGGCCAAGG - Intronic
1055513897 9:77018851-77018873 AGCGAGCGGCGGGCTGGAGAGGG - Intergenic
1057488558 9:95505893-95505915 CGCGGCCGCCGCGCTGGGGAGGG - Intronic
1061559606 9:131394181-131394203 CGGGGGCGGCGGGATGGCGGCGG - Intronic
1062022543 9:134326291-134326313 CGCGGGCCGAGCGGTGGCGGCGG + Intronic
1062462019 9:136666074-136666096 GGCGGGCGGCGCGGCGGGGAGGG + Intronic
1185736649 X:2500945-2500967 CGCGGGCGGCGCGGAAGCGGCGG - Exonic
1185750968 X:2609363-2609385 CGAGTGCAGCGCGCGGGCGAAGG - Intergenic
1185877740 X:3713704-3713726 CGGGGGCGGAGCGCGCGCGAAGG - Intergenic
1188003918 X:25004868-25004890 CGCGGTCGACGCGCTGGTCAGGG + Exonic
1198683281 X:139203984-139204006 GGAGGGCGGCGCGCACGCGAGGG + Intronic
1199942187 X:152637760-152637782 GCCGGGCGGCGCGCAGGCTACGG + Intergenic
1200231143 X:154444446-154444468 CGCGGGCGGCGCGCCGGGGCAGG + Intronic
1200249751 X:154546755-154546777 GGCGGGCGCCGCGCAGGCGGAGG - Intronic
1201291274 Y:12421897-12421919 CTCGGGCTGCGCGCTGGCCTTGG - Intergenic