ID: 1019112009

View in Genome Browser
Species Human (GRCh38)
Location 6:169724211-169724233
Sequence GTGAGAAGCGCCGCCGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019112009_1019112011 2 Left 1019112009 6:169724211-169724233 CCAGCGGCGGCGGCGCTTCTCAC 0: 1
1: 0
2: 1
3: 16
4: 81
Right 1019112011 6:169724236-169724258 CAGCCCAACCCGCCCGGCCGCGG 0: 1
1: 0
2: 0
3: 16
4: 153
1019112009_1019112010 -4 Left 1019112009 6:169724211-169724233 CCAGCGGCGGCGGCGCTTCTCAC 0: 1
1: 0
2: 1
3: 16
4: 81
Right 1019112010 6:169724230-169724252 TCACGTCAGCCCAACCCGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019112009 Original CRISPR GTGAGAAGCGCCGCCGCCGC TGG (reversed) Intronic
904181396 1:28668986-28669008 GTGCGTGCCGCCGCCGCCGCCGG + Intronic
905408822 1:37754320-37754342 GTGAGCAGAGGGGCCGCCGCGGG + Exonic
913191717 1:116418652-116418674 CCGCGAAGCGCCGCCTCCGCGGG - Intergenic
913205527 1:116534642-116534664 GTGGGCAGCGCCGCCGCGGCGGG - Intronic
920260540 1:204685272-204685294 CTGGGCAGCGCCGCCGCCGCCGG - Intronic
920352166 1:205344300-205344322 AGGAGAAGCGGAGCCGCCGCCGG + Exonic
922471957 1:225882303-225882325 GCCAGACACGCCGCCGCCGCAGG - Exonic
1064112313 10:12549903-12549925 GTGAGAAGCGAGGTTGCCGCAGG - Intronic
1074977680 10:118594728-118594750 GCGAGATGCGCCGCCTCAGCGGG + Exonic
1076372405 10:129963982-129964004 CTTCGAAGCGCCGCCGCCGCCGG - Intergenic
1077492798 11:2869935-2869957 GCGGGAAGCGCGGCCGCGGCCGG + Intergenic
1078801061 11:14644273-14644295 GGGAGCAGCGCCGCGGCTGCTGG - Exonic
1079163165 11:18012955-18012977 GCGAAGAGCGCGGCCGCCGCGGG + Exonic
1084028558 11:66467412-66467434 GGGGGGAGCGCCGCCTCCGCAGG + Intronic
1084225422 11:67712036-67712058 GTGCGAAGCGAGGCGGCCGCGGG - Intergenic
1090978386 11:131695026-131695048 GGGAGGAGCGCCGCCGCCGCCGG + Intronic
1091248903 11:134125022-134125044 TGGAGACGCGCCGCCGCCACCGG - Intronic
1091303606 11:134523469-134523491 GTGAGAACCGGGCCCGCCGCGGG + Intergenic
1095431978 12:42144456-42144478 GTGAGAGGCGCCGGCGTCGCGGG - Exonic
1102035603 12:109769016-109769038 GTGACCACCACCGCCGCCGCTGG - Exonic
1104429648 12:128705920-128705942 GGGGGATGCGCCGCCGCCCCAGG + Exonic
1104860318 12:131920037-131920059 GGAAGAAGCGCTGCAGCCGCAGG - Exonic
1106264751 13:28100267-28100289 GTGGGAAACGCCGGGGCCGCAGG + Intronic
1107958860 13:45541987-45542009 GGGAGAAGCCCGGCAGCCGCAGG - Intronic
1109858846 13:68171214-68171236 GGGGGAAGCGCCGGCGGCGCAGG - Intergenic
1114633276 14:24172950-24172972 GGGAGAAGCGGGGCCGCGGCAGG - Exonic
1115761840 14:36583405-36583427 CTGAGAAGCGCCCCCGCCCAGGG - Intergenic
1117097539 14:52314025-52314047 GCGAGAAACGCCGCTCCCGCCGG + Intergenic
1119219432 14:72893929-72893951 GAGAGAAGCCCCGCCGCGGCTGG + Intronic
1124500550 15:30223905-30223927 GCGAGAGGCGCAGCAGCCGCAGG - Intergenic
1124743023 15:32314762-32314784 GCGAGAGGCGCAGCAGCCGCAGG + Intergenic
1126134708 15:45378666-45378688 TCGGGAAGCGCCGCGGCCGCTGG + Exonic
1127117582 15:55743186-55743208 GTGGACAGCGCCGCGGCCGCGGG + Intergenic
1128119182 15:65133394-65133416 GCCTGAGGCGCCGCCGCCGCCGG - Exonic
1130095708 15:80854297-80854319 GGGAGAAGAGCCCCCGCCTCAGG - Intronic
1131108427 15:89749980-89750002 CTGAGAAGGGCCGCCGCGGTGGG + Exonic
1132619356 16:857037-857059 GTGAGAATCGCCTGCCCCGCGGG - Intronic
1132740194 16:1408288-1408310 GTGTGAAGCCCCGCCCCCGTGGG - Intronic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1136779105 16:32885961-32885983 GTGAGCCGGGCAGCCGCCGCGGG - Intergenic
1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG + Intergenic
1139364827 16:66427040-66427062 GGGAGCCGCGCCGCCGCCGAGGG + Intergenic
1140223752 16:73063150-73063172 GTCAGAGGCGCCGCCACCGGCGG + Intergenic
1142306069 16:89286387-89286409 GTGGGAAGGGCTGCAGCCGCGGG + Intronic
1142379227 16:89722084-89722106 GTGAGGAGCGCTGTCACCGCGGG + Intronic
1203081520 16_KI270728v1_random:1148049-1148071 GTGAGCCGGGCAGCCGCCGCGGG - Intergenic
1147719804 17:42532121-42532143 TGGAGAGGCGCCGCCGCCGCCGG + Intergenic
1150358053 17:64505483-64505505 GGGGGAAGCGCCGCCCCAGCGGG - Intronic
1153805717 18:8706714-8706736 GTGAGCCGCGCCTCGGCCGCAGG + Intronic
1160722541 19:603913-603935 GTGAGAGGCGCAGCAGCCGCAGG - Exonic
1161133784 19:2607752-2607774 GTGAGAAGCGGAGACGCCACTGG - Intronic
1161412418 19:4123890-4123912 GCTAGAGGCGCCGCCGCCGCCGG - Exonic
1161948427 19:7453554-7453576 GTGAGAAGGGCCAGCGCCTCAGG + Exonic
1167405580 19:49305625-49305647 GTGAGCAGCGCCGTCCCTGCTGG + Intronic
926198168 2:10775967-10775989 GGGAGGAGCGCCGTGGCCGCGGG + Intronic
935165094 2:100563159-100563181 GGGGGAAGCTCCGGCGCCGCAGG + Intronic
935570904 2:104659415-104659437 GAGAAAAGAGCCGCCGCCGAGGG + Intergenic
948688673 2:239688272-239688294 GTGGGAAGCGCCGCAGCTGGTGG - Intergenic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1174343874 20:49915421-49915443 GCGAGAGGCGCGGCTGCCGCCGG + Intronic
1178314811 21:31559036-31559058 CAGAGCAGCGCCGCCGCCGTCGG - Intronic
1178916760 21:36709269-36709291 GGGAGGAGCGCAGCCGCCGCAGG + Intronic
1180877010 22:19179195-19179217 GTGAGAAGGGGCTACGCCGCCGG + Intergenic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
953947574 3:47163352-47163374 GTCCGAGGCGCCGCCGTCGCGGG + Intronic
954211360 3:49099373-49099395 GTGGGAAGCCCCGCCGTCGCAGG + Exonic
961499595 3:127322828-127322850 GTGAGAAGGGCTGCCACCGCTGG + Intergenic
962289695 3:134123663-134123685 GAGAGAAGCCCCGCCGTCTCTGG - Intronic
969074650 4:4568419-4568441 GGGAGAAGCGCCACCCCTGCGGG + Intergenic
971153430 4:24058122-24058144 GTGAGAAGCCCCGCCCCAGAGGG + Intergenic
971327466 4:25655891-25655913 GTGAGTACCGCCGCCGGGGCAGG + Intronic
973551271 4:52038200-52038222 GTGAGTACCGCCGCGGCCGCGGG - Intronic
994353899 5:98774120-98774142 TTGAGCAGCGCCGCAGCCCCGGG + Exonic
998583615 5:143404195-143404217 GTGGCCCGCGCCGCCGCCGCCGG + Intronic
998820814 5:146056141-146056163 GTGAGAAGCACAGCCGGCCCTGG + Exonic
1002562268 5:180090492-180090514 GGGAGGAGCGCTGCCGCCGGAGG + Intergenic
1003049232 6:2765352-2765374 GCGCGAGGCGCCTCCGCCGCCGG + Intergenic
1006437642 6:34034521-34034543 GTGAGAAGAGAGGCCGCTGCAGG - Intronic
1016714097 6:147204076-147204098 GCGAGCAGCGGCGCGGCCGCGGG + Intergenic
1019112009 6:169724211-169724233 GTGAGAAGCGCCGCCGCCGCTGG - Intronic
1019343059 7:517555-517577 GCCAGGAGCGCCGCCGCCCCGGG + Intronic
1019343799 7:520169-520191 CGCAGAAGCGCCGCCGTCGCCGG + Intronic
1020097256 7:5376123-5376145 GTGAGAAGAGCTGCAGCTGCTGG + Exonic
1022943730 7:35262055-35262077 GTTAGAAGCCCCGCCGCTGCAGG + Intergenic
1027111392 7:75442607-75442629 CCGAGAAGCGCCGCCCCGGCCGG + Intronic
1027283633 7:76627166-76627188 CCGAGAAGCGCCGCCCCGGCCGG + Exonic
1030055892 7:105583328-105583350 CTGAGCAGCCCCGCCGCTGCCGG - Intronic
1030216010 7:107044637-107044659 GGGAGAGGCGCGGCCGCGGCTGG + Exonic
1032117056 7:129126481-129126503 GCTAGAGGCGCCGCCGCCACCGG + Intergenic
1034781762 7:153887852-153887874 GGGAGAAGCGCCGCCGCGCGCGG - Intronic
1035254643 7:157618563-157618585 GTGAAGAGCGCAGCGGCCGCAGG + Exonic
1035638356 8:1163732-1163754 GGGAGTAACGCGGCCGCCGCGGG + Intergenic
1040295293 8:46145869-46145891 GGGAGAAGCGGCGACACCGCAGG - Intergenic
1040311317 8:46238286-46238308 GGGAGAAGCGCCGAGACCGCAGG + Intergenic
1040312608 8:46244502-46244524 GGGAGAAGCGTCGCCACCACAGG + Intergenic
1049620722 8:143597325-143597347 GTGAGTACCGCGGCCCCCGCCGG - Intronic
1052888915 9:33677304-33677326 GCGAGAAACGCCGCCGCTGCCGG + Intergenic
1200252065 X:154559076-154559098 GTGAGAAGCGCCTCCCACACGGG + Intronic
1200265703 X:154645340-154645362 GTGAGAAGCGCCTCCCACACGGG - Intergenic