ID: 1019112647

View in Genome Browser
Species Human (GRCh38)
Location 6:169728970-169728992
Sequence TTAATGTTAAGAGATTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019112647_1019112648 12 Left 1019112647 6:169728970-169728992 CCACTTTAATCTCTTAACATTAA No data
Right 1019112648 6:169729005-169729027 ATGATGAAACCAGAATTTACTGG No data
1019112647_1019112650 22 Left 1019112647 6:169728970-169728992 CCACTTTAATCTCTTAACATTAA No data
Right 1019112650 6:169729015-169729037 CAGAATTTACTGGCTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019112647 Original CRISPR TTAATGTTAAGAGATTAAAG TGG (reversed) Intergenic
No off target data available for this crispr