ID: 1019112650

View in Genome Browser
Species Human (GRCh38)
Location 6:169729015-169729037
Sequence CAGAATTTACTGGCTGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019112647_1019112650 22 Left 1019112647 6:169728970-169728992 CCACTTTAATCTCTTAACATTAA No data
Right 1019112650 6:169729015-169729037 CAGAATTTACTGGCTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019112650 Original CRISPR CAGAATTTACTGGCTGAATA AGG Intergenic
No off target data available for this crispr