ID: 1019115542

View in Genome Browser
Species Human (GRCh38)
Location 6:169758500-169758522
Sequence GTGGTTAAACAGAGGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019115542 Original CRISPR GTGGTTAAACAGAGGCAGCA GGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
901821197 1:11830638-11830660 GTGGTTACAGAGAAGCAACAAGG - Intronic
902169267 1:14597917-14597939 ATGGGTAAACTGAGGCAGCAGGG + Intergenic
902830815 1:19011076-19011098 GTGGTTGAACACAGGCTGCAGGG - Intergenic
904751465 1:32743242-32743264 GAGGGTAAACACAGGCAGAATGG - Intronic
907211386 1:52825986-52826008 AAGGTTAAAAAGAGGTAGCAGGG + Exonic
907759858 1:57347074-57347096 GTGATTACACAAAGGCAGGAAGG + Intronic
907813557 1:57896120-57896142 GTTGTAAAACAGGGGCATCAAGG - Intronic
909715625 1:78702886-78702908 GTGGCCAAACAGATGCAGCTGGG - Intergenic
915808894 1:158885916-158885938 GGAGTTAAACAAAGGCAGTAAGG - Intergenic
915938643 1:160104228-160104250 GTGGACAAGCAGAGGAAGCAGGG - Intergenic
917505414 1:175622905-175622927 ATGGGGAAACAGAGGCACCAGGG - Intronic
917968071 1:180191055-180191077 GTGGACAATCCGAGGCAGCAGGG - Intronic
919416804 1:197320639-197320661 GTAGTTAAACAGAGGAAGATGGG + Intronic
919465354 1:197918034-197918056 TTGGTTTAACAGAGGGCGCAGGG - Intronic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920892436 1:210002419-210002441 GAGGTTAAGCAAAAGCAGCAAGG - Intronic
921798933 1:219379931-219379953 GTGGTGAAGAAGAGGCAGGAAGG + Intergenic
922349066 1:224721082-224721104 GAGGACAAACCGAGGCAGCACGG - Intronic
1063171542 10:3514219-3514241 GAGCTTAAACAGAGGCTTCATGG - Intergenic
1063951648 10:11228953-11228975 GTGGGTCAACAGAGGAAGAAAGG + Intronic
1064398275 10:14999057-14999079 GTGGGTTAAAAAAGGCAGCAAGG - Intergenic
1069746742 10:70719916-70719938 GTGTGTAAACAGAGGCAGTGTGG - Intronic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1070432739 10:76357595-76357617 GTAGTTAAGCACAGACAGCAGGG + Intronic
1072258992 10:93649479-93649501 GTGGATATACACAGGAAGCATGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1075789171 10:125071183-125071205 GAGGGGAAACAGAGGCAGCGAGG + Intronic
1079150027 11:17890117-17890139 GTGGCTAAGAAGGGGCAGCAGGG + Intronic
1083569752 11:63752669-63752691 GTGGTAAAACAGAAAAAGCAGGG + Intronic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1086441332 11:86832464-86832486 GTGGGTTAAAAAAGGCAGCAAGG - Intronic
1088659218 11:112028873-112028895 GTGGCGAAGCAGTGGCAGCAGGG - Exonic
1089079000 11:115760687-115760709 GCTGTGAAACAGAGGGAGCATGG - Intergenic
1090276532 11:125423953-125423975 ACAGTTAAACAGAGCCAGCATGG + Intronic
1091008997 11:131981332-131981354 GTGGTCAAACAGAGGCACATTGG - Intronic
1091566179 12:1649856-1649878 ATGATTAAAGAGAGGAAGCAGGG - Intergenic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1096507979 12:52108305-52108327 GTGGGTTAAAAAAGGCAGCAAGG + Intergenic
1098167470 12:67713180-67713202 GTGTTTAAACAAAAACAGCAAGG + Intergenic
1098339021 12:69432558-69432580 GAGGTTAAACAGAGTCATAAGGG - Intergenic
1099872096 12:88362202-88362224 GTGGTTAAACTAAGGCAGAGTGG + Intergenic
1100877353 12:98975838-98975860 GTGGTTGGGCAGAGGGAGCAGGG + Intronic
1100919121 12:99462576-99462598 TTGGTTAAAAAGATGCAGAAGGG - Intronic
1101148617 12:101864872-101864894 TTGCTTAAACCCAGGCAGCAGGG + Intergenic
1102462448 12:113108273-113108295 CTGCGTAAACTGAGGCAGCAAGG + Intronic
1104648511 12:130514167-130514189 GTGCTTTGAGAGAGGCAGCAGGG - Intronic
1106071412 13:26415572-26415594 GTGAATAAACAAATGCAGCAAGG + Intergenic
1106128987 13:26923885-26923907 GAAGTTAAACAGATGCAGAAAGG - Intergenic
1108052623 13:46461181-46461203 GTGGGTTAAAAAAGGCAGCAAGG + Intergenic
1109538423 13:63742864-63742886 GTGGGTTAACAAAGGCAGCAAGG + Intergenic
1109545415 13:63836908-63836930 GTGGGTTAACAAAGGCAGCAAGG - Intergenic
1109840469 13:67911990-67912012 GTGGGTTAAAAAAGGCAGCAAGG + Intergenic
1109962421 13:69648552-69648574 TTGCTTAAAGATAGGCAGCAAGG + Intergenic
1112199434 13:97260752-97260774 GTGGTTAAACAGAGGCCTGGTGG + Intronic
1113635032 13:111913532-111913554 GTGGCGGAAGAGAGGCAGCATGG - Intergenic
1113864074 13:113509512-113509534 GTGGCTAAACATAGGCGTCATGG - Intronic
1113880408 13:113622367-113622389 GCGGCCACACAGAGGCAGCAAGG - Intronic
1119441619 14:74632151-74632173 GTGGATAAACTGAGGCCCCAAGG - Intergenic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1122024543 14:98866163-98866185 GTGGCTACAGAGCGGCAGCAGGG + Intergenic
1122107295 14:99468128-99468150 GTATTTAAACAGAGGCAGTGTGG - Intronic
1126694815 15:51317000-51317022 GTGGCAAGACAGAGGGAGCATGG + Intronic
1129773677 15:78219105-78219127 GTGGTTAAGAAGATGCAGCTGGG - Intronic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1131436816 15:92429573-92429595 GAAATTCAACAGAGGCAGCAAGG - Intronic
1135507789 16:23053733-23053755 GTGTTTCAAAGGAGGCAGCAAGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1137898833 16:52243323-52243345 GTGGATACACAGTGACAGCAGGG + Intergenic
1140021790 16:71246098-71246120 GGGGTTAACCAGAGGCAGTATGG + Intergenic
1141781463 16:86164668-86164690 GTTGGGAAACAGAGGCACCAGGG + Intergenic
1143013299 17:3878278-3878300 GTGGATGAACAGAGGCACGAGGG - Intronic
1144026706 17:11283440-11283462 GTGCTTTAATAGAGGCAGGATGG - Intronic
1144296017 17:13875839-13875861 GAGGTTCTTCAGAGGCAGCAAGG + Intergenic
1145122557 17:20273646-20273668 GTGGTTAAAAACAGGAAGAATGG - Intronic
1145262283 17:21361511-21361533 GTGGCTGAACAGAGGGAGCGGGG - Intergenic
1147609251 17:41792060-41792082 GTGGGGAGATAGAGGCAGCATGG + Intergenic
1147643747 17:42021131-42021153 ATGGTTAAAGAGAGGAAGCTGGG + Intronic
1151377225 17:73698160-73698182 GTGGTTACGCAAAGGGAGCATGG - Intergenic
1151624187 17:75266447-75266469 ATGGGTAAACTGAGGCACCAAGG + Exonic
1153505319 18:5790910-5790932 GTGGTTAGACATTGGAAGCAAGG - Intergenic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1154284442 18:13039153-13039175 GTGATGAAAAGGAGGCAGCAGGG + Intronic
1158371818 18:56815040-56815062 TTGGTTAACCGGAGGTAGCAAGG + Intronic
1160360302 18:78269522-78269544 GTGGCTCAACAGAAGCAGAATGG - Intergenic
1160529440 18:79554993-79555015 GAGCTTAGACAGAGGCTGCAAGG + Intergenic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164749074 19:30637859-30637881 AGGGTTAGACAAAGGCAGCAAGG + Intronic
1165142116 19:33705807-33705829 GCTGTGACACAGAGGCAGCAGGG - Intronic
1167136262 19:47617984-47618006 GTTGGGAAACTGAGGCAGCAGGG + Intronic
1167961611 19:53109513-53109535 GTGGTGAAACTGAGGAACCATGG + Exonic
1168019700 19:53600310-53600332 GTGGTTAAACTAATTCAGCAAGG + Exonic
1168338262 19:55608964-55608986 GTGGTTGAAGAAAGGCAGCAAGG - Intronic
926727791 2:16012159-16012181 ATGGTTTAACAAAGGCATCATGG + Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
933374760 2:81465334-81465356 TCGTTTAAGCAGAGGCAGCATGG - Intergenic
936156704 2:110051633-110051655 GTGGATAAATAGAGGCAGAGAGG + Intergenic
936187988 2:110319811-110319833 GTGGATAAATAGAGGCAGAGAGG - Intergenic
936264844 2:110996177-110996199 GGGGTTAAACAGAAGCATCCTGG - Intronic
936375748 2:111939971-111939993 CTGATTAGACAGAGGCAGAAGGG - Intronic
937888286 2:126915414-126915436 TTGGGTATACAGAGGCACCAGGG - Intergenic
939864477 2:147457679-147457701 GTTTTTAAACAGAGGATGCAGGG - Intergenic
940871382 2:158863315-158863337 GTGGGTTAAAAAAGGCAGCAAGG + Intergenic
941987671 2:171523845-171523867 GTAGTTAGAGAAAGGCAGCAAGG + Intronic
943565176 2:189508613-189508635 GTGGTTACAAAAAGGCAACAAGG + Intergenic
946653419 2:221918731-221918753 GTGGGTAAACAGAGGAAGGCAGG - Intergenic
948902786 2:240964714-240964736 GTGGTTCAAAGGCGGCAGCAAGG - Intronic
1169707592 20:8523168-8523190 GTGGATGAATAAAGGCAGCAGGG - Intronic
1169758087 20:9064650-9064672 GTGGGGTCACAGAGGCAGCAGGG - Intergenic
1173082912 20:39886867-39886889 GTTTTGAAGCAGAGGCAGCAGGG - Intergenic
1173404051 20:42749484-42749506 GTGGTATAAAAGAGACAGCATGG + Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175939097 20:62529697-62529719 GTGCTCAAACAGCGGCAGCCTGG + Intergenic
1176959469 21:15142971-15142993 GTGGTGAAGTAGAGGAAGCATGG + Intergenic
1177094805 21:16819554-16819576 GAGGTGAAGCAGAGGAAGCAGGG - Intergenic
1178895488 21:36553877-36553899 GTGGCTAAACAGAGTCAACATGG - Intronic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179462072 21:41542920-41542942 GTGGTTAAACCTAAGCGGCAGGG + Intergenic
1180065393 21:45409721-45409743 GAGGGGAAACTGAGGCAGCAAGG - Intronic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1183479217 22:38053802-38053824 GTGGTTAAAAAGAGGAAGACAGG - Intergenic
1184344855 22:43907133-43907155 GTGGGGAAACTGAAGCAGCAAGG + Intergenic
1184400405 22:44270620-44270642 GTGGTCTCACAGAGGCAGGATGG - Intronic
951644407 3:24872288-24872310 GAGCTGAAACAAAGGCAGCAAGG - Intergenic
954322500 3:49841690-49841712 GGGTTCAAACAAAGGCAGCATGG + Intronic
956523903 3:70135858-70135880 GTGATTAAACACAAGAAGCAAGG - Intergenic
957042587 3:75347783-75347805 GTGGGTTAAAAAAGGCAGCAAGG - Intergenic
957045418 3:75370349-75370371 GTGGGTTAAAAAAGGCAGCAAGG - Intergenic
958445486 3:94209860-94209882 GTGGTGAGAGAGAAGCAGCAAGG + Intergenic
958922058 3:100118563-100118585 GTGCTTGAACAGAGGCCGCATGG - Intronic
960915493 3:122690269-122690291 ATGGCTAAAGAGTGGCAGCAGGG + Intronic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961274087 3:125713111-125713133 GTGGGTTAAAAAAGGCAGCAAGG + Intergenic
961276974 3:125735268-125735290 GTGGGTTAACAAAGACAGCAAGG + Intergenic
961871396 3:129991105-129991127 CTGATAAAACAGAGGCACCATGG + Intergenic
961877452 3:130034469-130034491 GTGGGTTAACAAAGACAGCAAGG - Intergenic
963909070 3:150799753-150799775 GTGGTTAAATAGAGGTGGCTGGG - Intergenic
965784901 3:172325098-172325120 CTGGTCACACACAGGCAGCAGGG - Intronic
966775189 3:183537477-183537499 GTTGTAAAACAGAGGTAGCTAGG + Intronic
967168780 3:186807489-186807511 GTGGTTATGCAGAGGAAGTAGGG + Intergenic
968073294 3:195801620-195801642 GTGGTAAAGAAGAGGCGGCAGGG - Intronic
968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG + Intronic
968869631 4:3235098-3235120 GTGGTCAAGCAGAGGCTGAAGGG + Intronic
969026142 4:4174257-4174279 GTGGGTTAAAAAAGGCAGCAAGG - Intergenic
969030301 4:4206748-4206770 GTGGGAAAACAGATTCAGCAAGG - Intronic
969787441 4:9470022-9470044 GTGGGTTAAAAAAGGCAGCAAGG + Intergenic
969825616 4:9755847-9755869 GTGGGTTAAAAAAGGCAGCAAGG + Intergenic
970372786 4:15424701-15424723 GTGGTTGAAGAGAGGCATCAAGG - Intronic
973597976 4:52512102-52512124 GTAGTTAAACAGAAAAAGCAGGG - Intergenic
974488484 4:62534030-62534052 GTGGAGAAATAGAGGCATCAAGG + Intergenic
977893600 4:102340256-102340278 GAGGGTAGAGAGAGGCAGCAGGG + Intronic
982179547 4:152737206-152737228 ATTGTTAAAAAGAGGGAGCAAGG + Intronic
983584179 4:169338223-169338245 GAAGTTTAACAGAAGCAGCAGGG - Intergenic
984206869 4:176795590-176795612 GTGGAGAAAGAGAGGTAGCAGGG + Intergenic
984373357 4:178894757-178894779 GTGGATAACCAGAGTGAGCAAGG + Intergenic
984706829 4:182853430-182853452 GTGGTGAACCAGAGGAAGAAAGG + Intergenic
985588518 5:753045-753067 CAGGTTAAACACAGGCAGCAGGG - Intronic
985603185 5:845484-845506 CAGGTTAAACACAGGCAGCAGGG - Intronic
985816481 5:2131803-2131825 GAGCGGAAACAGAGGCAGCATGG - Intergenic
986817059 5:11424341-11424363 GTGGCTAAAAAGGGGTAGCACGG + Intronic
988717377 5:33841386-33841408 GAGGTTAACCAGAGACAGGATGG - Intronic
990948538 5:61274304-61274326 GTGATTCCACAAAGGCAGCAAGG - Intergenic
990995774 5:61730933-61730955 GTGTTTAAGCAGAGGCACCATGG - Intronic
993432295 5:87846768-87846790 GTGGCTGAACAAAGACAGCAGGG - Intergenic
994988135 5:106964214-106964236 GTGTGTAAGCAGAGGTAGCAGGG + Intergenic
996899537 5:128528632-128528654 GTGGTTAAAAAGAGGCAGACAGG + Intronic
999248996 5:150170621-150170643 GTGGAGAGACAGAGGCAGCCAGG - Intronic
999505640 5:152193140-152193162 TAGGAGAAACAGAGGCAGCAGGG - Intergenic
1001164793 5:169354291-169354313 GTGGTTATAAAAAGGCAACAGGG + Intergenic
1001901721 5:175436529-175436551 GTGGACAGACAGAGGCAACAGGG + Intergenic
1003002454 6:2348922-2348944 GAGGTTGAACAAAGGCAGCAGGG - Intergenic
1003008982 6:2408926-2408948 GTGGCTAAACATGGGAAGCAGGG + Intergenic
1003283162 6:4711682-4711704 TGGGTTAAACAGAGGCACTATGG + Intronic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1006272552 6:32975157-32975179 GTGGTTAGAGAAAGGCAGCAGGG + Intronic
1007492061 6:42230830-42230852 GGGCTTAATCAGACGCAGCATGG + Intronic
1009676304 6:66826830-66826852 GTGAATAAGCAGAAGCAGCAGGG - Intergenic
1010869661 6:81021788-81021810 CAGGATTAACAGAGGCAGCATGG + Intergenic
1013573411 6:111453565-111453587 GTGGTAAAAGAGAGGCAGTATGG - Intronic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1020143086 7:5623007-5623029 GTTGTTGAACACAGGCCGCACGG + Exonic
1020193151 7:6016020-6016042 GAGGTTCAGCAGAGGCAGCCCGG + Intronic
1020312510 7:6879558-6879580 GTGGGTTAAAAAAGGCAGCAAGG - Intergenic
1020837507 7:13172046-13172068 TTTGTTAAACACAGGCAGCTGGG - Intergenic
1021281694 7:18727693-18727715 GAGGTAAAACAGAGGCAGCAGGG - Exonic
1021799520 7:24290329-24290351 GTGGTTAGAGACAGGAAGCAAGG - Intronic
1025907455 7:65798840-65798862 GTGGTTAAAAAAAGGCAGACTGG + Intergenic
1027798517 7:82723116-82723138 TTGCTTAATCAAAGGCAGCAAGG - Intergenic
1032063404 7:128744670-128744692 GTGAGGAAGCAGAGGCAGCAGGG + Intronic
1032333238 7:130999758-130999780 TTGCTCACACAGAGGCAGCATGG - Intergenic
1033122755 7:138680442-138680464 GAGGTTAAAAAGAAGCAGCCAGG - Intronic
1034871152 7:154685130-154685152 GTGTTGTAACAGAGCCAGCATGG + Intronic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1036904438 8:12696230-12696252 GTGGGTTAAAAAAGGCAGCAAGG - Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1041728707 8:61043313-61043335 GTAGTTAATCAAAAGCAGCATGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1047853604 8:128885613-128885635 TTTGTTAGACAGAGGCAGCAGGG - Intergenic
1048164779 8:132052944-132052966 ATGATTCAGCAGAGGCAGCAGGG - Intronic
1049266846 8:141672112-141672134 ATGGCTAAACCGAGGCACCAAGG - Intergenic
1055494336 9:76839739-76839761 GTAGTCAAAGAGAGGCAGAATGG + Intronic
1056098962 9:83282301-83282323 GTGGTTCAAAAGAGGCAAAATGG + Intronic
1056490491 9:87102091-87102113 GTGATAAAACTGAGACAGCAAGG - Intergenic
1056915465 9:90742438-90742460 GTGGGTTAAAAAAGGCAGCAAGG - Intergenic
1058899817 9:109432323-109432345 TTGGCAAAACAGTGGCAGCAAGG - Intronic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1062201196 9:135303700-135303722 GTGGTTAGAAAGAGGCTGCATGG - Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG + Intronic
1195994764 X:110720736-110720758 GTGTTTAAACTGAAGCAGGAAGG - Intronic
1199596187 X:149507950-149507972 GAGGATATAGAGAGGCAGCAAGG + Intronic
1199732703 X:150652222-150652244 GTGGAAAAACAGAGCCAGCATGG + Intronic
1200287606 X:154838625-154838647 GTGGTTAAACAGCAACAGTAGGG + Intronic
1200372762 X:155744411-155744433 GTGGTTAAACAGCAACAGTAGGG + Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic